Several distinct "CCAAT" box binding proteins coexist in eukaryotic cells.

Abstract

Even though a "CCAAT" box element is localized -80 base pairs upstream of the transcription initiation site in many eukaryotic promoters, it is not recognized by a single ubiquitous transcription factor. We show here that such a sequence present in the rat albumin promoter binds a protein distinct from the CCAAT-binding transcription factor CTF/NFI or from the CCAAT-binding protein (CBP) previously described. The protein binding to the albumin CCAAT sequence (ACF or albumin CCAAT factor) is not exclusive to liver, since we found a protein with identical properties in spleen.Albumin is the most abundant protein in plasma. It is synthesized mainly in liver; only trace amounts of specific mRNA are detected in some kidney cells and in brain (1, 2). The tissue specificity of albumin synthesis appears to be regulated at the level of transcription, since only liver cells or hepatoma cells in culture actively transcribe this gene (3,4). Recent studies have shown that =150 base pairs (bp) preceding the albumin mRNA initiation site are sufficient to direct tissue-specific expression of linked receptor genes in vivo or in vitro (2, 5-7). Additional sequences may be essential for transcriptional control during development, since a far upstream element present 10 kilobases (kb) 5' to the transcription start site is required for efficient expression of the albumin gene in transgenic mice (8).Comparison of the promoter sequences of albumin genes from mouse, rat, human, and chicken revealed several conserved segments in the 150 bp preceding the cap site (7, 9, 10). These elements include the widespread TATA and CCAAT consensus sequences as well as a proximal element and three distal elements (DEI, DEII, and DEIII) (Fig. 1). Analysis of deletions and linker scan mutants indicates that all these conserved elements contribute to the strength of the albumin promoter (ref. 7; P. Herbomel, F. Tronche, M. 0. Ott, A. Mottura-Rollier, M.Y., and M. Weiss, unpublished observations). Conservation of sequence motifs in the albumin promoters and their importance for the biological activity of this DNA fragment strongly suggest that these elements are binding sites for trans-acting factors. We have shown by DNase I "footprinting" that at least four distinct liver nuclear proteins interact with the proximal element and DEI, -II, . Surprisingly, the conserved -80 "CCAAT" box was not protected in these experiments. Furthermore, the protein interacting with albumin DEII -120 element was identified as nuclear factor I (NFI), shown recently to be identical to the CCAAT-binding transcription factor (CTF) (11). In fact, the conserved DEII includes the sequence TTGGCA (TGCCAA in the other strand) that is a good half-recognition site for NFL. It binds this factor with an affinity slightly lower than that of the symmetrical adenovirus NFI binding site (10). In the course of our DNase I footprinting studies, we realized that mutation of DEI, which abolished binding to this element, promoted partial protection of the CCAAT box sequences, suggestin...

Determinants of the brain‐specific expression of the rat aldolase C gene: ex vivo and in vivo analysis

“…With brain extracts, we observed a single, relatively diffuse band X, displaced by the homologous oligonucleotide but neither by Spl cons nor by D oligonucleotides (Fig. 5 A); [the D oligonucleotide which reproduces the box D sequence of the albumin promoter binds proteins of the CEBP family (Raymondjean et al, 1988)]. The complex formed with 3T6 fibroblast nuclear extracts consisted of a predominant band S and of a weak X;Y doublet.…”

“…Bacterial extracts with and without Spl, Krox20 and 0 0 x 2 4 recombinant protein were generously provided by P. Charnay. Double stranded oligonucleotides used as competitor were: D, the -109 to -86 site of the rat albumin gene promoter (Raymondjean et al, 1988) S'GGTATGATTTTG-TAATGCGGTAGG3'; and NFY, the -93 to -65 site of the rat albumin gene promoter (Raymondjean et al, 1988) 5'GGGGTAGGAACCAATGAAATGAAAGGTTA3'.…”

“…Nuclear extracts from adult rat liver and kidney were purified according to Gorski et al (1986) and DNase I footprinting and gel shift assays carried out as previously reported (Cereghini et a]., 1987;Raymondjean et al, 1988). Bacterial extracts with and without Spl, Krox20 and 0 0 x 2 4 recombinant protein were generously provided by P. Charnay.…”

Sterol regulation of human fatty acid synthase promoter I requires nuclear factor-Y- and Sp-1-binding sites

“…Sp-1 binds to the consensus sequence CGGGGCCCCG (25). NF-Y, also called CP1, is a heterotrimeric metalloprotein composed of three subunits-NF-Ya, NF-Yb, and NF-Yc (26)-and binds CCAAT boxes in various promoters such as albumin (27), globins (28), ␤-actin (29), ␣-collagen (30), and interleukin-4 (31). NF-Y subunit sequences are highly conserved among eukaryotes, and the yeast homolog heme-activated proteins can form heterotrimeric complexes with the corresponding mammalian subunits (32).…”

Genomic organization and DNA sequences of human 17β‐hydroxysteroid dehydrogenase genes and flanking regions

“…An inverted CAAT box, a binding site for multiple transcription factors (Dorn et al, 1987;Raymondjean et al, 1988), is situated -92 to -89-nucleotides relative to the transcription initiation site. Between the TATA box and the inverted CAAT box, a GC-rich region, located 71 -42-nucleotides upstream from the major transcription start point contained juxtaposed, putative binding sites for the transcription factors Spl (Dynan and Tjian, 1983) and AP-2 (Mitchell et al, 1987).…”