Serum Concentration of the Phytohormone Abscisic Acid Is Associated With Immune-Regulatory Mediators and Is a Potential Biomarker of Disease Severity in Chronic Obstructive Pulmonary Disease

Abstract

COPD and asthma are two distinct but sometimes overlapping diseases exhibiting varying degrees and types of inflammation on different stages of the disease. Although several biomarkers are defined to estimate the inflammatory endotype and stages in these diseases, there is still a need for new markers and potential therapeutic targets. We investigated the levels of a phytohormone, abscisic acid (ABA) and its receptor, LANCL2, in COPD patients and asthmatics. In addition, PPAR-γ that is activated by ABA in a ligand-binding domain-independent manner was also included in the study. In this study, we correlated ABA with COPD-propagating factors to define the possible role of ABA, in terms of immune regulation, inflammation, and disease stages. We collected blood from 101 COPD patients, 52 asthmatics, and 57 controls. Bronchoscopy was performed on five COPD patients and 29 controls. We employed (i) liquid chromatography–tandem mass spectrometry and HPLC to determine the ABA and indoleamine 2,3-dioxygenase levels, respectively; (ii) real-time PCR to quantify the gene expression of LANCL2 and PPAR-γ; (iii) Flow cytometry to quantify adipocytokines; and (iv) immunoturbidimetry and ELISA to measure CRP and cytokines, respectively. Finally, a multinomial regression model was used to predict the probability of using ABA as a biomarker. Blood ABA levels were significantly reduced in COPD patients and asthmatics compared to age- and gender-matched normal controls. However, PPAR-γ was elevated in COPD patients. Intriguingly, ABA was positively correlated with immune-regulatory factors and was negatively correlated with inflammatory markers, in COPD. Of note, ABA was increased in advanced COPD stages. We thereby conclude that ABA might be involved in regulation of COPD pathogenesis and might be regarded as a potential biomarker for COPD stages.

Abscisic acid inhibited reactive oxygen species‐mediated endoplasmic reticulum stress by regulating the PPAR‐γ signaling pathway in ARDS mice

“…Recently, our coauthor found that ABA ameliorated OVA‐induced allergic airway inflammation (Zhao et al, 2021). Moreover, clinical results have shown that ABA is positively correlated with immune‐regulatory factors and negatively correlated with inflammatory markers in patients with chronic obstructive pulmonary disease (Hoang et al, 2021). Our study extends the previous findings and investigates the effect of ABA in ARDS.…”

Immunophenotyping of Monocyte Migration Markers and Therapeutic Effects of Selenium on IL-6 and IL-1β Cytokine Axes of Blood Mononuclear Cells in Preoperative and Postoperative Coronary Artery Disease Patients

“…Calculation was performed using Ct values, averaged from duplicate measurements. The relative expression of a target transcript within a given sample was calculated using the delta (Δ) Ct method as previously described [ 46 ]. The sequences of the primers used in this study are (i) IL1B (forward: TACCTGTCCTGCGTGTTGAA and reverse: TCTTTGGGTAATTTTTGGGATCT) and (ii) B2M (forward: TTCTGGCCTGGAGGCTATC and reverse: TCAGGAAATTTGACTTTCCATTC).…”

Engineering a highly sensitive biosensor for abscisic acid in mammalian cells

“…However, the ABA dose of 340 mgÁkg À1 BW is relatively high compared to the dose used for the therapeutic/ prophylactic treatment [22]. We thus examined whether our improved biosensor could detect ABA levels in mice treated with the dose of ABA close to the therapeutic level (100 mgÁkg À1 feed), which was opted for several studies investigating the effect of ABA in a mouse model of colitis [15][16][17], atherosclerosis [28], and systemic inflammation (lipopolysaccharide model) [29]. We were able to detect ABA in serum of mice given ABA-supplemented diets for 7 days, which was also confirmed by liquid chromatography-mass spectrometry analysis (LC-MS) (Fig.…”

“…Recent findings of the beneficial role of ABA administration in human clinical trials against type II diabetes (T2D) [6][7][8][9][10] and experimental animal models of several diseases, including inflammatory bowel disease [11,12], depression [13,14], and neuroinflammation [15,16], have proposed the potential use of ABA as a therapeutic or prophylactic agent for diseases of the metabolism-immune and gut-brain axes. Moreover, previous studies reported a difference in serum ABA levels between patients diagnosed with moderate and severe chronic obstructive pulmonary disease (COPD) [17], or between human high-grade and low-grade glioma tissues [18], suggesting ABA as a potential biomarker for the severity of these disorders.…”