Serial cultivation of chicken keratinocytes, a composite cell type that accumulates lipids and synthesizes a novel β-keratin

Vanhoutteghem, Amandine; Londero, Tiphanie; Ghinea, Nicolae; Djian, Philippe

doi:10.1111/j.1432-0436.2004.07204002.x

Cited by 37 publications

(57 citation statements)

References 65 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The evolutionary persistence of involucrin and its continuing repeat additions are astonishing, in view of the fact that ablation (33) and RNA was isolated. RT-PCR was carried out by using primers 5Ј CTGGCAGTCA-GAGCTGTGCAC (sense) and 5Ј GGCGGATTCCCTTGGTCAGGAAT (antisense) with 30 cycles.…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Ancient origin of the gene encoding involucrin, a precursor of the cross-linked envelope of epidermis and related epithelia

Vanhoutteghem

Djian

Green

2008

Proc. Natl. Acad. Sci. U.S.A.

Self Cite

View full text Add to dashboard Cite

The cross-linked (cornified) envelope is a characteristic product of terminal differentiation in the keratinocyte of the epidermis and related epithelia. This envelope contains many proteins of which involucrin was the first to be discovered and shown to become cross-linked by a cellular transglutaminase. Involucrin has evolved greatly in placental mammals, but retains the glutamine repeats that make it a good substrate for the transglutaminase. Until recently, it has been impossible to detect involucrin outside the placental mammals, but analysis of the GenBank and Ensembl databases that have become available since 2006 reveals the existence of involucrin in marsupials and birds. We describe here the properties of these involucrins and the ancient history of their evolution.aves ͉ marsupial ͉ evolution ͉ glutamine repeats T he outer surface of the skin of humans and other mammals consists of dead cells, each of which contains a chemically resistant envelope. The nature of this envelope has been extensively reviewed (1, 2). Envelopes formed in cultures of epidermal cells are insoluble in ionic detergents at 100°C, but are dissolved by proteolytic enzymes (3). The envelopes are Ϸ120 Å in thickness (4) and composed of proteins heavily cross-linked by -(␥ glutamyl) lysine (isopeptide) bonds introduced by the action of transglutaminase (5). A protein ultimately incorporated into the cross-linked envelope was discovered as a soluble precursor before the activation of the cross-linking (6, 7). This precursor was named involucrin (from the Latin for envelope: involucrum) and was present only in enlarging cells undergoing terminal differentiation (8,9). Because involucrin is a substrate of transglutaminase, it is not surprising that it contains numerous glutamines capable of participating in the cross-linking reaction. Human involucrin contains 38-42 repeats of a 10 amino acid sequence, each repeat containing 3 glutamine residues (10-13).Other protein precursors of the cross-linked envelope were soon discovered (14). One had a molecular mass of 210 kDa and was later named envoplakin (15). Another had a molecular mass of 195 kDa and was later named periplakin (16). Still other precursors were discovered, including filaggrin (17), small proline-rich repeat proteins or SPRRs (18), and loricrin (19). The genes encoding most envelope precursors (but not periplakin or envoplakin) are located in the region of human chromosome 1q21, the so-called EDC or epidermal differentiation complex (20). This has been shown for involucrin (13), filaggrin (21), loricrin (22), cornifin (23), the SPRRs (24), and others (25). Other proteins encoded in the EDC, such as cornulin (26), appear late in terminal differentiation, but are not envelope precursors. Still others are precursors that are incorporated after the envelope is formed, particularly the ''late envelope proteins'' (27). It has been proposed that because involucrin, loricrin, and SPRR proteins have similar amino acid sequences in their N-terminal and C-terminal domains, they probab...

show abstract

Section: Discussionmentioning

confidence: 99%

“…Newborn-chicken keratinocytes were cultivated as described in ref. 33. When the cells were confluent, we prepared total RNA and carried out an RT-PCR specified for the predicted chicken involucrin mRNA.…”

Section: Detection Of Involucrin In Cultured Cells and Epidermis Of Gmentioning

confidence: 99%

Ancient origin of the gene encoding involucrin, a precursor of the cross-linked envelope of epidermis and related epithelia

Vanhoutteghem

Djian

Green

2008

Proc. Natl. Acad. Sci. U.S.A.

Self Cite

View full text Add to dashboard Cite

show abstract

“…Human epidermal keratinocytes derived from foreskin of a newborn (strain YF23) were propagated on mitomycin-treated 3T3-J2F cells as described in ref. 29. Indirect immunofluorescence staining was carried out as described earlier in ref.…”

Section: Methodsmentioning

confidence: 99%

Basonuclins 1 and 2, whose genes share a common origin, are proteins with widely different properties and functions

Vanhoutteghem

Djian

2006

Proc. Natl. Acad. Sci. U.S.A.

Self Cite

View full text Add to dashboard Cite

Basonuclin (bn) 1 possesses three separated pairs of zinc fingers and a nuclear localization signal. It is largely confined to the basal cells of stratified squamous epithelia and to reproductive germ cells. bn1 can shuttle between the nucleus and the cytoplasm, and its location is correlated with the proliferative potential of the cell. The recently discovered bn2 also possesses three separated pairs of zinc fingers and a nuclear localization signal. Conservation of the zinc fingers and the nuclear localization signal by bn1 and bn2 indicates a common origin. However, in contrast to bn1, bn2 is found in virtually every cell type and is confined to the nucleus. Bn2 but not bn1 colocalizes with SC35 in nuclear speckles and, therefore, is likely to have a function in nuclear processing of mRNA.RNA processing ͉ speckles ͉ zinc fingers B asonuclin (bn1) is a zinc finger protein with highly restricted tissue distribution: It is found mainly in basal keratinocytes of stratified squamous epithelium and in reproductive germ cells (1-5). bn1 possesses three separated pairs of zinc fingers, a nuclear localization signal (NLS) and a serine-rich region that has been called the serine stripe (1). Although the evidence is not conclusive, it seems that the function of bn1 is related to the potential for cell proliferation (6). The only known function of bn1 is that of a transcription factor in the synthesis of ribosomal RNA (7, 8), but it is possible that bn1 possesses a nucleoplasmic function in the regulation of expression of genes transcribed by RNA polymerase II (9).A gene encoding a second basonuclin (bn 2) recently has been discovered (10, 11). Although the deduced amino acid sequences of bn1 and bn2 are only slightly Ͼ40% identical, bn2 possesses all of the characteristic features of bn1 described above. The bn2 mRNA is abundant in cell types that possess bn1 but is also found in tissues that lack bn1, such as kidney, intestine, and uterus. The genes for bn1 and bn2 differ greatly in size and are located on different chromosomes, but it is clear that they have a common evolutionary origin. The evolutionary conservation of bn2 is much greater than that of bn1. It has been postulated that the gene for bn2 is the older of the two. After its duplication, the gene for bn1 was free to evolve in other directions, whereas the gene for bn2 remained virtually invariant (9, 11).Previous work on immunocytological detection of bn1 was carried out with polyclonal antisera raised against most or all of the bn1 protein (6, 12). In view of the similarities between bn1 and bn2, it was possible that these antisera did not distinguish between the two basonuclins. To detect each basonuclin independently, we generated antibodies to specific determinants not shared by bn1 and bn2. Using these antibodies, we show that, although the two basonuclins are of common origin, they possess widely different functions, because bn2 is likely to have a function in pre-mRNA processing. ResultsEvolutionary Conservation of bn2. We had reported that bn2 was e...

show abstract

“…lipoproteins) (Trams, 1969). Lastly, the Late stage corresponds to the period when mallards develop their carotenoid-based integument coloration, which requires upregulation of unidentified physiological mechanisms (Vanhoutteghem et al, 2004) required for pigment deposition (McGraw et al, 2002). We prepared diets by mixing a base diet of dry food (weeks 0-7: Mazuri Waterfowl Starter, Richmond, IN, USA; thereafter: Mazuri Waterfowl Maintenance) with ORO-GLO dry pigmenter (2% carotenoids by mass, predominately lutein; Kemin AgriFoods North America, Des Moines, IA, USA) suspended in sunflower oil to achieve concentrations of 25μgg -1 of carotenoids (upper quartile of carotenoid concentration in mallard duckling diets in the wild) (Butler and McGraw, 2010).…”

Section: Materials and Methods Experimental Protocol And Blood Collecmentioning

confidence: 99%

Immune function is related to adult carotenoid and bile pigment levels, but not dietary carotenoid access during development, in female mallard ducks

Butler

McGraw

2013

Journal of Experimental Biology

View full text Add to dashboard Cite

SUMMARYImmune function can be modulated by multiple physiological factors, including nutrition and reproductive state. Because these factors can vary throughout an individual's lifetime as a result of environmental conditions (affecting nutrition) or life-history stage (e.g. entering the adult reproduction stage), we must carefully examine the degree to which developmental versus adult conditions shape performance of the immune system. We investigated how variation in dietary access to carotenoid pigmentsa class of molecules with immunostimulatory properties that females deposit into egg yolks -during three different developmental time points affected adult immunological and reproductive traits in female mallard ducks (Anas platyrhynchos). In males and females of other avian species, carotenoid access during development affects carotenoid assimilation ability, adult sexual ornamentation and immune function, while carotenoid access during adulthood can increase immune response and reproductive investment (e.g. egg-laying capacity, biliverdin deposition in eggshells). We failed to detect effects of developmental carotenoid supplementation on adult immune function [phytohemagglutinin-induced cutaneous immune response, antibody production in response to the novel antigen keyhole limpet hemocyanin (KLH), or oxidative burst, assessed by changes in circulating nitric oxide levels], carotenoid-pigmented beak coloration, ovarian development, circulating carotenoid levels or concentration of bile pigments in the gall bladder. However, we did uncover positive relationships between circulating carotenoid levels during adulthood and KLH-specific antibody production, and a negative relationship between biliverdin concentration in bile and KLH-specific antibody production. These results are consistent with the view that adult physiological parameters better predict current immune function than do developmental conditions, and highlight a possible, previously unstudied relationship between biliverdin and immune system performance.

show abstract

Serial cultivation of chicken keratinocytes, a composite cell type that accumulates lipids and synthesizes a novel β-keratin

Cited by 37 publications

References 65 publications

Ancient origin of the gene encoding involucrin, a precursor of the cross-linked envelope of epidermis and related epithelia

Ancient origin of the gene encoding involucrin, a precursor of the cross-linked envelope of epidermis and related epithelia

Basonuclins 1 and 2, whose genes share a common origin, are proteins with widely different properties and functions

Immune function is related to adult carotenoid and bile pigment levels, but not dietary carotenoid access during development, in female mallard ducks

Contact Info

Product

Resources

About