Sequencing of hsp65 Distinguishes among Subsets of the Mycobacterium avium Complex

Abstract

The Mycobacterium avium complex consists of epidemiologically distinct subsets. The classification of these subsets is complicated by a number of factors, including the ambiguous results obtained with phenotypic and genetic assays and the recent appreciation that human and avian strains appear to be distinct. In previous work, sequencing based on a 441-bp portion of the hsp65 gene has proven to efficiently classify isolates within the Mycobacterium genus but provides low resolution for distinguishing among members of the M. avium complex. Therefore, in this study, we have targeted the more variable 3 region of the hsp65 gene to determine whether it can effectively discriminate M. avium complex isolates at the levels of species and subspecies. Primers designed for this target consistently generated amplicons for all organisms classified as M. avium complex. Sequences obtained indicate that M. intracellulare is genetically divergent from M. avium organisms, and distinct sequevars were obtained for M. avium subsets, including M. avium subsp. avium (bird type), M. avium subsp. hominissuis, and M. avium subsp. paratuberculosis. In addition, sequence differences served to distinguish bovine from ovine strains of M. avium subsp. paratuberculosis. A unique profile for M. avium subsp. silvaticum was not obtained. These results indicate that sequencing the 3 region of the hsp65 gene can simply and unambiguously distinguish species and subspecies of the M. avium complex.

Genomic Comparison of PE and PPE Genes in the Mycobacterium avium Complex

“…A study by Turenne et al (52), who used a PCR-and sequencing-based strategy to investigate the complete hsp65 gene in the MAC, identified 10 SNPs that differentiated M. avium subsp. hominissuis and M. avium subsp.…”

“…The corresponding gene products could be used to identify immune responses against this M. avium subspecies, and misinterpretations due to cross-reactivity in current diagnostics for Johne's disease would thereby be avoided. This subspecies is a heterogeneous group of strains with at least six distinct hsp65 sequences (hsp65 sequevars) (52). This has previously led to the suggestion that human isolates simply reflect what is found in their environment (44).…”

rpoB sequence-based identification of Mycobacterium avium complex species

“…For ITS amplification and sequencing, we used primers Ec16S.1390p and Mb23S.44n (Frothingham & Wilson, 1993) and 38 cycles of an initial 5 min denaturation at 95 uC, followed by 30 s denaturation at 94 uC, 30 s annealing at 62 uC and 90 s extension at 72 uC, with final extension for 7 min. For amplification and sequencing of the 39 end of hsp65, we initially used the primer pair hsp65-574F and hsp65-R (Turenne et al, 2006); since these primers failed to amplify the homologous sequence in M. colombiense, we further designated primers hsp65-F106 (59 AACGTCGTCCTGGAGAAGAA 39) and hsp65-R1558 (59 GC CTTCTCCGGCTTGTC 39), which covered almost the entire hsp65 gene in this species with hsp65-574F (59 GGTTCGACAAGGGYTACATC 39) as an additional primer for sequencing the 39 region of the gene. The conditions of PCR were 5 min at 95 uC, followed by 35 cycles of 95 uC for 45 s, 60 uC for 45 s and 72 uC for 90 s, with a final extension for 7 min.…”

“…paratuberculosis strains and disclosed six M. avium subsp. hominissuis sequavars (Turenne et al, 2006). Intergenic spacer (ITS) sequencing (Abed et al, 1995;Barry et al, 1991;Glennon et al, 1994;Roth et al, 1998) further subdivided MAC into 32 sequevars and recently delineated M. chimaera (Tortoli et al, 2004) and M. colombiense (Murcia et al, 2006).…”

Mycobacterium marseillense sp. nov., Mycobacterium timonense sp. nov. and Mycobacterium bouchedurhonense sp. nov., members of the Mycobacterium avium complex

“…PCR amplification and sequencing were performed for the 16S rRNA gene (Weisburg et al, 1991), the ITS-1 spacer (Frothingham & Wilson, 1993) and for parts of the hsp65 (Turenne et al, 2006) and rpoB genes (Ben Salah et al, 2008). Products of the sequencing reactions were analysed with an ABI Prism 3100 DNA sequencer following the standard protocol of the supplier (Perkin Elmer Applied Biosystems).…”