Sequencing and de novo analysis of a coral larval transcriptome using 454 GSFlx

Meyer, Eli; Aglyamova, Galina V.; Wang, Shi; Carter, Jade; Abrego, David; Colbourne, John K.; Willis, Bette L.; Matz, Mikhail V.

doi:10.1186/1471-2164-10-219

Cited by 415 publications

(471 citation statements)

References 46 publications

(62 reference statements)

Supporting

Mentioning

425

Contrasting

Unclassified

Order By: Relevance

“…9.9% in the razor clam Sinonovacula constricta (Niu et al, 2013), 12% in the blue mussel Mytilus galloprovincialis (Craft et al, 2010), 17% in the Antarctic bivalve Laternula elliptica (Clark et al, 2010;Meyer et al, 2009), 24% in the Manila clam Ruditapes philippinarum (Milan et al, 2011), 25% in the krill Euphausia superba (Clark et al, 2011), 28% in the Yesso scallop Pactinopecten yessoensis (Hou et al, 2011) and 39% in the sea cucumber Apostichopus japonicus (Du et al, 2012). This is almost certainly due to the genome sequencing and annotation of a close relative; the Pacific oyster, Crassostrea gigas (Zhang et al, 2012a).…”

Section: Functional Annotationmentioning

confidence: 99%

“…Indeed whole genome or transcriptome sequencing has proved a very efficient and cost effective method for expanding the sequence database for bivalves and other non-model species (i.e. Clark et al, 2010;Craft et al, 2010;Hou et al, 2011;Joubert et al, 2010;Meyer et al, 2009), and so was applied here to the transcriptome of the mangrove oyster C. brasiliana. In the last few years, several oyster genomes have become available, including the Pacific oyster Crassostrea gigas (Zhang et al, 2012a) and Pearl oyster Pinctada fucata (Takeuchi et al, 2012), significantly enriching the genomic resources for this animal model.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Key metabolic pathways involved in xenobiotic biotransformation and stress responses revealed by transcriptomics of the mangrove oyster Crassostrea brasiliana

et al. 2015

View full text Add to dashboard Cite

Key metabolic pathways involved in xenobiotic biotransformation and stress responses revealed by transcriptomics of the mangrove oyster Crassostrea brasiliana.Aquatic Toxicology http://dx.doi.org/10. 1016/j.aquatox.2015.06.012 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. Highlights-Thetranscriptome of the mangrove oyster Crassostrea brasilianawas sequenced.-The sequencing effort dramatically expanded the existing cDNA sequences available for the species.-Global analysis for transcription in the oyster treated with phenanthrene, diesel and domestic sewage was performed.-The pollutants altered mRNAs for genes in biotransformation, antioxidant and stress response pathways. Abstract 2The Brazilian oyster Crassostrea brasiliana was challenged to three common environmental contaminants: phenanthrene, diesel fuel water-accommodated fraction (WAF) and domestic sewage. Total RNA was extracted from the gill and digestive gland, and cDNA libraries were sequenced using the 454 FLX pla orm. The assembled transcriptome resulted in ˜20,000contigs, which were annotated to produce the first de novo transcriptome for C. brasiliana.Sequences were screened to identify genes potentially involved in the biotransformation of xenobiotics and associated antioxidant defence mechanisms. These gene families included those of the cytochrome P450 (CYP450), 70kDa heat shock, antioxidants, such as glutathione Stransferase, superoxide dismutase, catalase and also multi-drug resistance proteins. Analysis showed that the massive expansion of the CYP450 and HSP70 family due to gene duplication identified in the Crassostrea gigas genome also occurred in C. brasiliana, suggesting these processes form the base of the Crassostrea lineage. Preliminary expression analyses revealed several candidates biomarker genes that were up-regulated during each of the three treatments, suggesting the potential for environmental monitoring.

show abstract

Section: Functional Annotationmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Key metabolic pathways involved in xenobiotic biotransformation and stress responses revealed by transcriptomics of the mangrove oyster Crassostrea brasiliana

et al. 2015

View full text Add to dashboard Cite

show abstract

“…DAVID uses the Fisher's exact test to ascertain statistically significant gene enrichment for a particular pathway, and significant processes were selected based on a corrected P-value o0.05. We applied the corrected P-value (Benjamini correction) with a cutoff of 0.05 for filtering the significantly enriched pathways and a P-value of 0.001 for filtering enriched GO categories (Huang da et al, 2009a;Meyer et al, 2009). …”

Section: Functional Profile and Gene Ontology (Go) Enrichment Analysesmentioning

confidence: 99%

Unfolding the secrets of coral–algal symbiosis

et al. 2014

View full text Add to dashboard Cite

Dinoflagellates from the genus Symbiodinium form a mutualistic symbiotic relationship with reefbuilding corals. Here we applied massively parallel Illumina sequencing to assess genetic similarity and diversity among four phylogenetically diverse dinoflagellate clades (A, B, C and D) that are commonly associated with corals. We obtained more than 30 000 predicted genes for each Symbiodinium clade, with a majority of the aligned transcripts corresponding to sequence data sets of symbiotic dinoflagellates and o2% of sequences having bacterial or other foreign origin. We report 1053 genes, orthologous among four Symbiodinium clades, that share a high level of sequence identity to known proteins from the SwissProt (SP) database. Approximately 80% of the transcripts aligning to the 1053 SP genes were unique to Symbiodinium species and did not align to other dinoflagellates and unrelated eukaryotic transcriptomes/genomes. Six pathways were common to all four Symbiodinium clades including the phosphatidylinositol signaling system and inositol phosphate metabolism pathways. The list of Symbiodinium transcripts common to all four clades included conserved genes such as heat shock proteins (Hsp70 and Hsp90), calmodulin, actin and tubulin, several ribosomal, photosynthetic and cytochrome genes and chloroplast-based hemecontaining cytochrome P450, involved in the biosynthesis of xanthophylls. Antioxidant genes, which are important in stress responses, were also preserved, as were a number of calcium-dependent and calcium/calmodulin-dependent protein kinases that may play a role in the establishment of symbiosis. Our findings disclose new knowledge about the genetic uniqueness of symbiotic dinoflagellates and provide a list of homologous genes important for the foundation of coral-algal symbiosis.

show abstract

“…RNA extraction, quality control and analyses were performed as already described (D'Angelo et al 2008). The sequence of a coral-homolog of PCNA from the EST database of A. millepora (Meyer et al 2009) was aligned with PCNAs of higher organisms, and primers were designed against conserved regions. Fragments encoding PCNA were amplified from 500 ng cDNA using the primers: PCNA For ( 5 0atgtttgaagcaaagcttacacaaggc 3 0) and PCNA Rev ( 5 0 catattcttgttctgggatcccaag 3 0).…”

Section: Rna Preparation and Rt-pcrmentioning

confidence: 99%

Locally accelerated growth is part of the innate immune response and repair mechanisms in reef-building corals as detected by green fluorescent protein (GFP)-like pigments

et al. 2012

View full text Add to dashboard Cite

Homologs of the green fluorescent protein (GFP) are a prevalent group of host pigments responsible for the green, red and purple-blue colours of many reefbuilding corals. They have been suggested to contribute to the striking coloration changes of different corals species in response to wounding and infestation with epibionts/parasites. In order to elucidate the physiological processes underlying the potentially disease-related colour changes, we have analysed spatial and temporal expression patterns of GFP-like proteins and other biomarkers in corals from the Red Sea, the Arabian/Persian Gulf and Fiji both in their natural habitat and under specific laboratory conditions. The expression of distinct GFP-like proteins and the growth marker proliferating cell nuclear antigen was upregulated in growing branch tips and margins of healthy coral colonies as well as in disturbed colony parts. Furthermore, phenoloxidase activity increased in these proliferating tissues. It is thus demonstrated that locally accelerated growth is part of the innate immune response and repair mechanisms in reef-building corals and, moreover, these processes can be detected utilizing the excellent biomarker properties of GFP-like proteins. Finally, the results of this work suggest an additional vulnerability of corals in predicted future scenarios of increased ocean acidification, warming and eutrophication that are anticipated to reduce coral growth capacity.

show abstract

Sequencing and de novo analysis of a coral larval transcriptome using 454 GSFlx

Cited by 415 publications

References 46 publications

Key metabolic pathways involved in xenobiotic biotransformation and stress responses revealed by transcriptomics of the mangrove oyster Crassostrea brasiliana

Key metabolic pathways involved in xenobiotic biotransformation and stress responses revealed by transcriptomics of the mangrove oyster Crassostrea brasiliana

Unfolding the secrets of coral–algal symbiosis

Locally accelerated growth is part of the innate immune response and repair mechanisms in reef-building corals as detected by green fluorescent protein (GFP)-like pigments

Contact Info

Product

Resources

About