Sequences of 10 Variants of the Satellite-like RNA-3 of Groundnut Rosette Virus

Blok, Vivian C.; Ziegler, Angelika; Robinson, David J.; Murant, A. F.

doi:10.1006/viro.1994.1318

Cited by 44 publications

(38 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Mutagenesis of the AUG initiation codons in pYB3b was done with a U-DNA mutagenesis kit (Boehringer) according to the manufacturer's protocol. The mutagenic primers were as follows (ORFs numbered as in Blok et al, 1994 ;see Fig. 3).…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Trans-acting untranslated elements of groundnut rosette virus satellite RNA are involved in symptom production.

Taliansky¹,

Robinson²

1997

Journal of General Virology

View full text Add to dashboard Cite

Section: Methodsmentioning

confidence: 99%

“…Moreover, different variants of the sat-RNA are responsible for the different forms of rosette disease, such as green rosette and chlorotic rosette (Murant & Kumar, 1990). The sequences of 10 variants of GRV sat-RNA have been determined (Blok et al, 1994).…”

Section: Introductionmentioning

confidence: 99%

Trans-acting untranslated elements of groundnut rosette virus satellite RNA are involved in symptom production.

Taliansky¹,

Robinson²

1997

Journal of General Virology

View full text Add to dashboard Cite

“…In the case of GRV, satellite RNA is found in all naturally occurring isolates, and is primarily responsible for the symptoms of groundnut rosette disease (Murant et al, 1988;Murant & Kumar, 1990). GRV satellite RNA is an ssRNA of 895-903 nt, which relies on GRV for its replication (Blok et al, 1994) and, more unusually, is also required for the Groundnut rosette assistor virus (GRAV)-dependent aphid transmission of GRV (Murant, 1990). Thus, unlike most virus satellite RNAs, it is essential for the biological survival (though not the replication) of its helper virus.…”

Section: Genome Organization Expression and Replicationmentioning

confidence: 99%

“…The role of the satellite RNA in the transmission process is to mediate transcapsidation of GRV RNA by GRAV protein to form stable aphid-transmissible hybrid virus particles (Robinson et al, 1999). Although different GRV satellite RNA variants contain up to five potential ORFs (Blok et al, 1994), none of the ORFs are essential for any of the functions and biological properties that have been ascribed to GRV satellites, including aphid transmission of GRV (Taliansky & Robinson, 1997;Robinson et al, 1999). In contrast, the satellite RNA that is associated with some isolates of PEMV-2 is not required for transcapsidation of PEMV-2 RNA by the CP of its assistor virus PEMV-1 or for aphid transmission of the hybrid particles (Demler et al, 1996b), and other umbraviruses, such as CMoV, do not have satellite RNAs, yet are transcapsidated by their assistors and thus transmitted by aphids.…”

mentioning

confidence: 99%

Molecular biology of umbraviruses: phantom warriors

Taliansky¹,

Robinson²

2003

Journal of General Virology

109

View full text Add to dashboard Cite

The genomes of umbraviruses differ from those of most other viruses in that they do not encode a coat protein, and thus no virus particles are formed in infected plants. Protection of umbraviral RNA outside the host plant, during vector transmission, utilizes the coat protein of an assistor luteovirus, but this review focuses on the mechanisms that compensate for the lack of a coat protein in processes within the host plant. As well as an RNA-dependent RNA polymerase, umbravirus genomes encode two other proteins from almost completely overlapping open reading frames. One of these is a cell-to-cell movement protein that can mediate the transport of homologous and heterologous viral RNAs through plasmodesmata without the participation of a coat protein. The other, the ORF3 protein, binds to viral RNA to form filamentous ribonucleoprotein particles that have elements of helical structure. It serves to stabilize the RNA and facilitates its transport through the vascular system of the plant. It may also be involved in protection of the viral RNA from the plant's defensive RNA-silencing response, although it is not a suppressor of silencing. The ORF3 protein also enters the cell nucleus, specifically targeting the nucleolus. Although the function of this localization is unknown, the ORF3 protein may provide a valuable tool for investigating plant nucleolar function. INTRODUCTIONOne of the main characteristics of most viruses is the formation of virus particles or virions, in which the viral genomic nucleic acid (RNA or DNA) is protected by encapsidation with one or more types of capsid (or coat) protein (CP). In virions, molecules of CP are packed into regular uniform structures based on either helical or icosahedral symmetry. In plant viruses, CP is also involved in transmission by biological vectors and often in the spread of viruses in infected plants. Some plant viruses, such as Cowpea mosaic virus (CPMV; Wellink & van Kammen, 1989), Potato virus X (PVX; Santa Cruz et al., 1998) or Cucumber mosaic virus (CMV; Canto et al., 1997), require CP for movement both through plasmodesmata (cell-to-cell movement) and via the phloem (long-distance movement). Others, such as Tobacco mosaic virus (TMV), require CP for long-distance movement but not for cell-to-cell movement (Carrington et al., 1996). Umbraviruses are distinguished from most other viruses by their lack of a gene for CP, and as a result these viruses do not form conventional virus particles.The name of the genus Umbravirus is derived from the Latin umbra, which means shadow, both in the physical sense and in the metaphorical senses of a phantom or an uninvited guest who comes with an invited one. This name reflects the way in which umbraviruses depend for survival in nature on an assistor virus, which is always a member of the family Luteoviridae (referred to here as a 'luteovirus'). For transmission between plants, CP of luteovirus forms aphidtransmissible hybrid virus particles, encapsidating umbraviral RNA (for review, see Taliansky et al., 2000). In nature,...

show abstract

“…Arrows sl-s5 and ci--c7 represent the primers used for cloning and sequencing, as listed in Table I I0 30 50 70 90 GGGGGUUUCAACAUGGCGACUAUAAGG CACAUUA UGGAUUGG CUGCGG C CAACAUUCACACCUCUUGCUGGUGUA.AAAUCCCGG CAAGAGUGUAUUGCGC M A T I R H I M D W L R P T F T P L A G V K S R Q E C I A H ii0 130 150 170 190 AUUAUGGGGAUGACUGGGCCCUAAUGAUCACCCAGUCCAGAAUGACCCUI/UCCG CUGAGG C CCAGGUGAACGCCUGGUAUGAGGGGGGAGCCGAAGUGAA Y G D D W A L M I T Q S R M T L S A E A Q V N A W Y E G G A E V N 210 230 250 270 290 CGGCUCCAUUC CCUCAGUGGAAGGGAACGCAG CCG 1910 1930 1950 1970 1990 UGGCUUCACCAUGAAGGUGGAGGAGC CGG UCUACUCUCUGGAACGAGUGGACUUCUG C CAAACGAGAC CCGUCUAUGAUGGGAAGAAAUGGAGGAUGGUG 18"5% (v/v) ethanol and chromatographed twice on Whatman CF-11 cellulose. Total ssRNA was isolated from GRV-infected N. benthamiana as described by Blok et al (1994).…”

Section: Methodsmentioning

confidence: 99%