Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Thomsen, Bo; Mollerup, Steen; Bonven, Bjarne; Frank, Rainer; Blöcker, Helmut; Nielsen, Ole F.; Westergaard, Ole

doi:10.1002/j.1460-2075.1987.tb02436.x

Cited by 93 publications

(57 citation statements)

References 26 publications

(18 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Camptothecin, a specific inhibitor that blocks resealing of the cleavage by a DNA-bound topoisomerase I molecule, was used to reveal the largest possible number ofDNA sites active in the topoisomerization reaction. Reactions of eukaryotic DNA topoisomerase I, run without camptothecin, revealed fewer cleaved sites than with camptothecin (21). Accordingly, the smear-like appearance of the cleavage pattern of the 2318-bp domain with camptothecin ( Fig.…”

Section: Resultsmentioning

confidence: 90%

Regulation of the function of eukaryotic DNA topoisomerase I: topological conditions for inactivity.

Camilloni

Martino

Mauro

et al. 1989

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

The effects of supercoiling on the cleavage reaction by eukaryotic DNA topoisomerases I (wheat germ, chicken erythrocyte, and calf thymus) have been analyzed on DNA fragments (0.96 and 2.3 kilobases) encompassing an immunoglobulin K light-chain promoter. In one topological condition of the substrate, the absolutely relaxed state, cleavage was found to be impeded. This rmding defines the topologydependent step of the eukaryotic DNA topoisomerase I reaction and shows that for the cleavage reaction topology is more critical than sequence effects. These rmdings suggest a simple model for the regulation of the DNA topoisomerase I reaction based on topological factors, which may explain the regulatory function of the enzyme in in vivo eukaryotic transcription.The enzymology of the DNA topoisomerase I reaction is known in detail (1), but the biological function ofthis reaction is not known. Isolation of conditional mutants has allowed the study of DNA topoisomerase I effects on transcription in both prokaryotes (1) and eukaryotes (2). The fact that expression of transfected DNA in eukaryotes depends on DNA topology (3) and that a topological "swivel" is needed in transcription supports the involvement of DNA topoisomerases I as regulators of DNA topology in this process (4). Nonsupercoiled closed circular duplex molecules are assumed to be substrates for DNA topoisomerase I (5), and even linear DNA has been commonly observed as a substrate for the nicking reaction (6-8). Therefore, one faces a paradox when addressing the function of DNA topoisomerase I: how can this enzyme regulate or be part of the regulation of DNA topology when its reaction has no apparent topological requirements? We report our analysis of the cleavage-step dependence of the DNA topoisomerase I reaction upon the topology of the DNA substrate. The study was performed with three different DNA topoisomerases I (wheat germ, chicken erythrocyte, and calf thymus) on topologically programmed forms of a 2.3-kilobase (kb) DNA segment encompassing the promoter and part of the coding sequences of the mouse MPC-11 cell line immunoglobulin K light-chain (LK) gene and on a 0.96-kb subclone centered on the promoter region. The results show a strict topological requirement for the reactivity of the three enzymes and reveal that a distinct topological condition, the complete absence of torsional stress, impedes the function of DNA topoisomerases I. MATERIALS AND METHODSRestriction endonucleases and T4 DNA ligase were purchased from New England Biolabs and Boehringer Mannheim. Ethidium bromide (EtdBr) and camptothecin were purchased from Sigma, and radiochemicals were purchased from NEN. Chicken erythrocyte DNA topoisomerase I was purified as reported (9); wheat germ and calf thymus DNA topoisomerases I were, respectively, from Promega Biotec and New England Biolabs. The DNAs used in this study are (i) 2318-base-pair (bp) Xba I-Xba I fragment encompassing 439 bp upstream of the RNA initiation site, the leader exon, the first intron, including the three remai...

show abstract

Section: Resultsmentioning

confidence: 90%

Regulation of the function of eukaryotic DNA topoisomerase I: topological conditions for inactivity.

Camilloni

Martino

Mauro

et al. 1989

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

show abstract

“…The MUT target duplex contains three mutated base pairs (in bold) in the triplex site so that the TFO can no longer bind. The B2 target is modified on the 3Ј side of the triplex (in bold) in order to abolish Topo I cleavage sites b and c. Duplex TID was obtained by inserting at the 3Ј end of the triplex an 8-bp sequence encompassing a wellknown CPT cleavage site from the rRNA gene of Tetrahymena thermophilus characterized by Westergaard and coworkers (1,25). For all four duplexes, a 324-bp restriction fragment was 32 P radiolabeled and incubated in the presence of the conjugates and Topo I.…”

Section: Downloaded Frommentioning

confidence: 99%

“…To further characterize this feature, we used a duplex containing, instead of sites b and c, a strong CPT cleavage site (in bold) 4 bp from the 3Ј triplex end (distance appropriate for targeting with the TFO-CPT conjugates studied (2, 7), called site B (5Ј GAGAGAGAGAAAAAAACTCCAAGTCT 3Ј/3Ј CTC TCTCTCTTTTTTTGAGGTTCAGA 5Ј] in duplex TID). This site was built from a CPT-sensitive site present in the rRNA gene previously studied by Westergaard and coworkers (1,25). The cleavage pattern in the presence of CPT was, compared to the unmutated target duplex (WT), modified only at the 3Ј side of the triplex site, where site B appeared, located 4 bp from the triplex end (Fig.…”

Section: Downloaded Frommentioning

confidence: 99%

Exploring the Cellular Activity of Camptothecin-Triple-Helix-Forming Oligonucleotide Conjugates

Arimondo

Thomas

Oussedik

et al. 2006

Molecular and Cellular Biology

View full text Add to dashboard Cite

Topoisomerase I is a ubiquitous DNA-cleaving enzyme and an important therapeutic target in cancer chemotherapy for camptothecins (CPTs). These drugs stimulate DNA cleavage by topoisomerase I but exhibit little sequence preference, inducing toxicity and side effects. A convenient strategy to confer sequence specificity consists of the linkage of topoisomerase poisons to DNA sequence recognition elements. In this context, triple-helix-forming oligonucleotides (TFOs) covalently linked to CPTs were investigated for the capacity to direct topoisomerase I-mediated DNA cleavage in cells. In the first part of our study, we showed that these optimized conjugates were able to regulate gene expression in cells upon the use of a Photinus pyralis luciferase reporter gene system. Furthermore, the formation of covalent topoisomerase I/DNA complexes by the TFO-CPT conjugates was detected in cell nuclei. In the second part, we elucidated the molecular specificity of topoisomerase I cleavage by the conjugates by using modified DNA targets and in vitro cleavage assays. Mutations either in the triplex site or in the DNA duplex receptor are not tolerated; such DNA modifications completely abolished conjugate-induced cleavage all along the DNA. These results indicate that these conjugates may be further developed to improve chemotherapeutic cancer treatments by targeting topoisomerase I-induced DNA cleavage to appropriately chosen genes.Topoisomerase I (Topo I) is a ubiquitous nuclear enzyme involved in the control of DNA topology. During the catalytic cycle, the enzyme transiently cleaves DNA and forms a covalent 3Ј-phosphorotyrosyl adduct usually referred to as the cleavage complex (14,28,29). A number of drugs, such as the antitumor alkaloid camptothecin (CPT) (for reviews, see references 17 and 24) and indolocarbazole analogs of the antibiotic rebeccamycin family (9,23,30), act by blocking the religation step after DNA cleavage, thereby enhancing the formation of cleavage complexes (DNA/Topo I/drug ternary complexes), which constitute persistent DNA breaks believed to be responsible for cell death (20)(21)(22)28). Topo I poisons stimulate DNA cleavage at many sites along the double helix with a limited sequence preference (one or two bases around the cleavage site). However, the sequence specificity of the Topo I poison can be considerably enhanced by linkage to a DNA recognition element. Initially, Matteucci et al. (19) showed in vitro that the covalent attachment of CPT to a triple-helix-forming oligonucleotide (TFO) induces site-specific DNA cleavage near the end of the triple helix. In the same context, we showed that CPT and rebeccamycin derivatives covalently linked to a TFO induce Topo I to mediate a sequence-specific DNA cleavage near the triplex site (3, 6, 7) according to a preferred geometry (2). The use of triple-helical DNA structures offers an efficient strategy to target Topo I to specific DNA sequences. Consequently, TFO-drug conjugates may be potentially exploited to improve the efficacy and selectivity of chemo...

show abstract

“…The oligonucleotide (Fig. 4C) contained the hexadecameric sequence from the rDNA of Tetrahymena plus upstream and downstream base pairs that are known to be important for maximal Topo I cleavage of this high affinity binding site (18,19,(32)(33)(34)(35)(36). The results demonstrate that, as with the plasmid DNA, cleavage of full-length Topo I to generate the ϳ73-kDa fragment was only slightly inhibited (Ͻ2-fold) by the presence of the duplex oligonucleotide (compare lanes 3-6 to lanes 12-15 of panel A).…”

mentioning

confidence: 99%

“…B, Topo70 was digested under the same conditions described above for full-length Topo I. C, the duplex 22-mer used in the above experiments contains the hexadecameric sequence (underlined), which is known to be a high affinity binding site for mammalian topoisomerases (19,35,36). The site of Topo I cleavage is indicated with a small arrow.…”

mentioning

confidence: 99%

The Domain Organization of Human Topoisomerase I

Stewart¹,

Ireton

Champoux

1996

Journal of Biological Chemistry

162

156

View full text Add to dashboard Cite

Using limited proteolysis, we show that the domain boundaries of human topoisomerase I closely parallel those predicted from sequence comparisons with other cellular Topo I enzymes. The enzyme is comprised of (i) an NH 2 -terminal domain (ϳ24 kDa), which is known to be dispensable for activity, (ii) the core domain (ϳ54 kDa), (iii) a linker region (ϳ3 kDa), and (iv) the COOHterminal domain (ϳ10 kDa), which contains the active site tyrosine. The highly conserved core and COOH-terminal domains are resistant to proteolysis, while the unconserved NH 2 -terminal and linker domains are sensitive. Noncovalent binding of Topo I to plasmid DNA or to short duplex oligonucleotides decreases the sensitivity of the linker to proteolysis by approximately a factor of 10 but has no effect on proteolysis of the NH 2 -terminal domain. When the enzyme is covalently complexed to an 18 base pair single-stranded oligonucleotide, the linker region is sensitive to proteolysis whether or not duplex DNA is present. The net positive charge of the linker domain suggests that at a certain point in catalysis the linker may bind directly to DNA. Further, we show that limited subtilisin cleavage can generate a mixture of 60-kDa core and ϳ10-kDa COOH-terminal fragments, which retain a level of topoisomerase activity that is nearly equal to undigested control samples, presumably because the two fragments remain associated after proteolytic cleavage. Thus, despite its potential role in DNA binding, the linker domain (in addition to the NH 2 -terminal domain) appears to be dispensable for topoisomerase activity. Finally, the limited proteolysis pattern of the human enzyme differs substantially from the limited proteolysis pattern of the vaccinia viral Topo I, indicating that the two enzymes belong to separate eukaryotic topoisomerase I subfamilies. This results in the formation of a phosphotyrosine bond between the enzyme and the 3Ј end of the broken strand. Reversal of the transesterification reaction restores the phosphodiester bond and liberates the enzyme. Two models, free rotation and enzyme-bridging, have been proposed to explain the mechanism by which Topo I promotes topoisomerization of the DNA (reviewed in Ref. 1). The free rotation model proposes that the 5Ј end of the broken strand is released from the active site and is allowed to freely rotate about the unbroken strand. The enzyme-bridging model proposes that the unbroken strand is passed through an enzyme-bridged break, formed by covalent attachment to the 3Ј end of the broken strand and noncovalent binding to the 5Ј end of the broken strand.Sequence comparisons of the cellular eukaryotic Topo I enzymes 2 reveals the human enzyme (765 residues, 91 kDa) can be divided into four domains (see preceding paper (5) 2 In the accompanying paper (5) we demonstrate that the NH 2 -terminal domain is mostly if not completely unstructured, an observation that is consistent with the fact that this domain is sensitive to proteolysis and is dispensable for activity (5-9).Weak amino acid sequence hom...

show abstract

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Cited by 93 publications

References 26 publications

Regulation of the function of eukaryotic DNA topoisomerase I: topological conditions for inactivity.

Regulation of the function of eukaryotic DNA topoisomerase I: topological conditions for inactivity.

Exploring the Cellular Activity of Camptothecin-Triple-Helix-Forming Oligonucleotide Conjugates

The Domain Organization of Human Topoisomerase I

Contact Info

Product

Resources

About