Sequence-indexed mutations in maize using the UniformMu transposon-tagging population

Settles, A. Mark; Holding, David R.; Tan, Bao Cai; Latshaw, Susan; Liu, Juan; Suzuki, Masaharu; Li, Li; O'Brien, Brent; Fajardo, Diego; Wroclawska, Ewa; Tseung, Chi-Wah; Lai, Jinsheng; Hunter, Charles T.; Avigne, Wayne T.; Baier, John; Messing, Joachim; Hannah, L. Curtis; Koch, Karen E.; Becraft, Philip W.; Larkins, Brian A.; McCarty, Donald R.

doi:10.1186/1471-2164-8-116

Cited by 128 publications

(125 citation statements)

References 44 publications

Supporting

Mentioning

121

Contrasting

Unclassified

Order By: Relevance

“…The allele agpsemzmMutator1 (Mu1) was present in the UniformMu maize population (McCarty et al, 2005;Settles et al, 2007). UniformMu lines are isogenic in the W22-ACR inbred background and contain sequence-indexed insertions of Mu transposable elements.…”

Section: Mutations Of Agpsemzm and Agpllzm And Effects On Agpase Actimentioning

confidence: 99%

Functions of Multiple Genes Encoding ADP-Glucose Pyrophosphorylase Subunits in Maize Endosperm, Embryo, and Leaf

2013

View full text Add to dashboard Cite

ADP-glucose pyrophosphorylase (AGPase) provides the nucleotide sugar ADP-glucose and thus constitutes the first step in starch biosynthesis. The majority of cereal endosperm AGPase is located in the cytosol with a minor portion in amyloplasts, in contrast to its strictly plastidial location in other species and tissues. To investigate the potential functions of plastidial AGPase in maize (Zea mays) endosperm, six genes encoding AGPase large or small subunits were characterized for gene expression as well as subcellular location and biochemical activity of the encoded proteins. Seven transcripts from these genes accumulate in endosperm, including those from shrunken2 and brittle2 that encode cytosolic AGPase and five candidates that could encode subunits of the plastidial enzyme. The amino termini of these five polypeptides directed the transport of a reporter protein into chloroplasts of leaf protoplasts. All seven proteins exhibited AGPase activity when coexpressed in Escherichia coli with partner subunits. Null mutations were identified in the genes agpsemzm and agpllzm and shown to cause reduced AGPase activity in specific tissues. The functioning of these two genes was necessary for the accumulation of normal starch levels in embryo and leaf, respectively. Remnant starch was observed in both instances, indicating that additional genes encode AGPase large and small subunits in embryo and leaf. Endosperm starch was decreased by approximately 7% in agpsemzm-or agpllzm-mutants, demonstrating that plastidial AGPase activity contributes to starch production in this tissue even when the major cytosolic activity is present.Plant ADP-glucose pyrophosphorylase (AGPase) catalyzes the production of ADP-glucose (ADPGlc) and inorganic pyrophosphate (PPi) from Glc-1-P and ATP, thus generating the nucleotide sugar used by starch synthases to incorporate glucosyl units into starch. ADPGlc formation is an important metabolic control point and thus has been a genetic engineering target for crop improvement. Altering AGPase activity by transgenic means resulted in elevated yields in several starch-producing crops, including rice (Oryza sativa), maize (Zea mays), wheat (Triticum aestivum), and potato (Solanum tuberosum), although the precise nature of the metabolic and developmental changes that result remains to be elucidated (Stark et al., 1992;Greene and Hannah, 1998;Smidansky et al., 2002Smidansky et al., , 2003Smidansky et al., , 2007Hannah et al., 2012).AGPase localization appears to be strictly plastidial in most plant tissues, whereas in cereal endosperms, the majority of the enzyme is cytosolic and a minor form resides within amyloplasts (for review, see ComparotMoss and Denyer, 2009;Hannah and Greene, 2009;Geigenberger, 2011). Such an arrangement necessitates distinct modes of regulation and metabolic control of starch biosynthesis compared with other plants, including transport of ADPGlc and Glc phosphate (Glc-1-P and/or Glc-6-P) from the cytosol into the amyloplast. Subcellular fractionation revealed that 85% to 95% ...

show abstract

Section: Mutations Of Agpsemzm and Agpllzm And Effects On Agpase Actimentioning

confidence: 99%

Functions of Multiple Genes Encoding ADP-Glucose Pyrophosphorylase Subunits in Maize Endosperm, Embryo, and Leaf

2013

View full text Add to dashboard Cite

show abstract

“…We also performed informatics searchers of the databases for the RescueMu (Lunde et al 2003) and UniformMu (Settles et al 2007) projects. No tga1 mutants were found in any of these collections, however, five Mu insertion events were identified in neighbor of tga1 (not1), a gene closely related to tga1 , from TUSC using a Mu terminal repeat primer (5'-agagaagccaacgccawcgcctcyatttcgtc-3') with a primer designed from tga1 (5'agaaagcgtctggacgggcacaatc3').…”

Section: Screening For Tga1 Mutants and Identification Of Neighbor Ofmentioning

confidence: 99%

Evidence That the Origin of Naked Kernels During Maize Domestication Was Caused by a Single Amino Acid Substitution intga1

et al. 2015

View full text Add to dashboard Cite

teosinte glume architecture1 (tga1), a member of the SBP-box gene family of transcriptional regulators, has been identified as the gene conferring naked kernels in maize vs. encased kernels in its wild progenitor, teosinte. However, the identity of the causative polymorphism within tga1 that produces these different phenotypes has remained unknown. Using nucleotide diversity data, we show that there is a single fixed nucleotide difference between maize and teosinte in tga1, and this difference confers a Lys (teosinte allele) to Asn (maize allele) substitution. This substitution transforms TGA1 into a transcriptional repressor. While both alleles of TGA1 can bind a GTAC motif, maize-TGA1 forms more stable dimers than teosinte-TGA1. Since it is the only fixed difference between maize and teosinte, this alteration in protein function likely underlies the differences in maize and teosinte glume architecture. We previously reported a difference in TGA1 protein abundance between maize and teosinte based on relative signal intensity of a Western blot. Here, we show that this signal difference is not due to tga1 but to a second gene, neighbor of tga1 (not1). Not1 encodes a protein that has 92% amino acid similarity to TGA1 and that is recognized by the TGA1 antibody. Genetic mapping and phenotypic data show that tga1, without a contribution from not1, controls the difference in covered vs. naked kernels. No trait differences could be associated with the maize vs. teosinte alleles of not1. Our results document how morphological evolution can be driven by a simple nucleotide change that alters protein function. KEYWORDS tga1; glume architecture; teosinte; maize; domestication A LTHOUGH the study of adaptive evolution through natural or artificial selection dates back to Darwin, the genetic mechanisms that drive changes in morphology remain strongly debated (Stern and Orgogozo 2008). Questions surrounding the number of genes (few or many) and types of mutations (regulatory or coding) in these genes have been a focus in this debate (Carroll 2005(Carroll , 2008Hoekstra and Coyne 2007). These questions can only be answered through the genetic and molecular dissection of genes that have undergone selective pressure between lineages or within populations. Crop species offer a powerful system for investigating these questions since crops are the products of continuous directional selection to adapt them to the human controlled environment and human needs (Meyer and Purugganan 2013). Research on crop models is further facilitated by the extensive genetic and genomic resources available for them. Moreover, because of the recent divergence of crop species from their wild progenitors, crop-progenitor pairs remain cross-compatible and amenable to genetic analysis.Maize was domesticated in the central Balsas valley of Mexico 9000 years ago from a wild relative called teosinte (Piperno et al. 2001;Matsuoka et al. 2002). Because the morphology of modern maize is drastically different from teosinte species, the progenitor of mai...

show abstract

“…By linking large numbers of mutants with phenotypes of interest, crop plant mutation libraries have historically served as an important way to associate genes with their functions Settles et al, 2007;Krishnan et al, 2009). Previously, however, no comprehensive collection of sorghum mutant populations was available.…”

Section: Introductionmentioning

confidence: 99%

A Sorghum Mutant Resource as an Efficient Platform for Gene Discovery in Grasses

et al. 2016

View full text Add to dashboard Cite

Sorghum (Sorghum bicolor) is a versatile C4 crop and a model for research in family Poaceae. High-quality genome sequence is available for the elite inbred line BTx623, but functional validation of genes remains challenging due to the limited genomic and germplasm resources available for comprehensive analysis of induced mutations. In this study, we generated 6400 pedigreed M4 mutant pools from EMS-mutagenized BTx623 seeds through single-seed descent. Whole-genome sequencing of 256 phenotyped mutant lines revealed >1.8 million canonical EMS-induced mutations, affecting >95% of genes in the sorghum genome. The vast majority (97.5%) of the induced mutations were distinct from natural variations. To demonstrate the utility of the sequenced sorghum mutant resource, we performed reverse genetics to identify eight genes potentially affecting drought tolerance, three of which had allelic mutations and two of which exhibited exact cosegregation with the phenotype of interest. Our results establish that a large-scale resource of sequenced pedigreed mutants provides an efficient platform for functional validation of genes in sorghum, thereby accelerating sorghum breeding. Moreover, findings made in sorghum could be readily translated to other members of the Poaceae via integrated genomics approaches.

show abstract

Sequence-indexed mutations in maize using the UniformMu transposon-tagging population

Cited by 128 publications

References 44 publications

Functions of Multiple Genes Encoding ADP-Glucose Pyrophosphorylase Subunits in Maize Endosperm, Embryo, and Leaf

Functions of Multiple Genes Encoding ADP-Glucose Pyrophosphorylase Subunits in Maize Endosperm, Embryo, and Leaf

Evidence That the Origin of Naked Kernels During Maize Domestication Was Caused by a Single Amino Acid Substitution intga1

A Sorghum Mutant Resource as an Efficient Platform for Gene Discovery in Grasses

Contact Info

Product

Resources

About