Sequence homology between EF‐1α, the α‐chain of elongation factor 1 from Artemia salina and elongation factor EF‐TU from Escherichia coli

Abstract

In the course of a structural analysis of the a-chain of elongation factor 1 from Artemia sulina cysts, we present four amino acid sequences comprising together half of the polypeptide chain. A comparison of these sequences with the primary structure of elongation factor EF-Tu from Escherichia coli reveals a clear correspondence between the eukaryotic and prokaryotic protein throughout their polypeptide chains. The results support a basic conservation of the structure of the aminoacyl-tRNA carrying enzyme in evolution.The occurrence, in the eukaryotic factor, of several c-trimethyllysine residues, is remarkable.

A bacterial clone carrying sequences coding for elongation factor EF‐1α from Artemia

“…Some DNA sequences were obtained after isolation of the EcoRI-Hind111 pUC8 fragment containing the cDNA insert in the PstI sites. Fig.3b shows the entire nucleotide sequence of the cDNA insert and the derived amino acid sequence, which is in agreement with the partial sequence of the protein chain [6]. Both sides of the cDNA show the presence of oligo(dC) tails, but no poly(A) tract was found at the 3 '-end of the coding sequence.…”

“…The cDNA sequence codes for the protein se- ACTGCCACACAGCTCACATTGCTTGCAAGTTTGCTTAGATTAAAGAG~GTGTGACAGAC 310 320 330 340 350 360 T G K T T E A E P K FIKSGDAAMI GTACTGGCAAAACAACTGAAGCTGAGCCAAAATTTATCAAGTCAGGTGATGCGGCCATGA 370 300 390 400 410 420 T LVPSKP LCVEAF SDFPPLG TCACTTTGGTACCTTCCAAGCCGTTGTGTGTTGAAGCCTTTTCCGACTTCCCACCTCTTG 430 440 450 460 470 480 RFAVRDM RQTVAVGVI K S V N GTCGATTTGCTGTCCGTGACATGAGACAAACAGTCGCTGTCGGAGTTATCAAGTCCGTCA 490 500 510 520 530 quence as determined for a C-terminal part of the protein [6]. Points of difference are that the Glu residue in position 99 corresponds to the serine codon TCC and a histidine triplet is found instead of a glycine at position 262.…”

Translational dynamics

“…The part of the factor that is involved in guanosine nucleotide binding has not been determined, but both eEF-la and eEF-2 have sequences similar to the region in EF-Tu and yas p21 constituting the guanosine-nucleotide-binding pocket (amino acids 9-28, 81-138 in eEF-la) [135-1391. This highly conserved domain seems to be a common feature of most GTP binding proteins [140,1411. eEF-la and EF-Tu show a major difference in affinity for guanosine nucleotides.…”

“…In reticulocytes, there are approximately six copies of eEF-la per ribosome [155], but no systematic correlation between the in vivo level of tRNA and eEF-la has been made. eEF-1 a has a trypsin-sensitive arginine-glycine bond between positions 68 and 69 [140,156,1571. The trypsin sensitivity is low in the eEF-1 .…”

Genes for elongation factor EF‐1α in the brine shrimp Artemia

“…EF-lcu, as such present in nauplii, has an A4r of about 50000 and binds aminoacyltRNA, while EF-lay, like prokaryotic EF-Ts, stimulates the exchange of guanine nucleotides [7]. Sequence analysis of parts of the EF-la protein chain of Artemia reveals a clear homology to distinct regions in EF-Tu from E. coli [8]. EF-Tu is encoded by two nearly identical but unlinked genes (tufA and tu$B), providing a challenging model for studying the regulation of gene expression in E. coli [9].…”