Sequence and Functional Analysis of a Homolog of Interleukin-10 Encoded by the Parapoxvirus Orf Virus

Fleming, Stephen B.; Haig, David M.; Nettleton, P. F.; Reid, H.W.; McCaughan, Catherine A.; Wise, Lyn M.; Mercer, Andrew A.

doi:10.1007/978-1-4615-1707-8_8

Cited by 30 publications

(37 citation statements)

References 61 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…It has been shown that Tat induces IL-10 production in infected PBMCs both in vitro and also in infected patients (54). This phenomenon seems to be not only restricted to HIV-1 since certain other viruses like CMV and pox viruses skew the immune response similarly (55,56). To look at the role of IL-10 in Tatmediated immunosuppression, we have immunized IL-10 Ϫ/Ϫ mice with bicistronic vector and found that the immunosuppressive effect of Tat was abrogated, suggesting that Tat uses the host's immune regulation pathway for benefit of virus.…”

Section: Discussionmentioning

confidence: 98%

HIV-1 Tat Suppresses gp120-Specific T Cell Response in IL-10-Dependent Manner

Gupta

Boppana

Mishra

et al. 2008

The Journal of Immunology

View full text Add to dashboard Cite

A large number of multicomponent vaccine candidates are currently in clinical evaluation, many of which also include the HIV-1 Tat protein, an important regulatory protein of the virus. However, whether Tat, a known immune effector molecule with a well-conserved sequence among different HIV subtypes, affects the immune response to a coimmunogen is not well understood. In this study, using a bicistronic vector expressing both gp120 and Tat, we have analyzed the role of Tat in elicitation of the gp120-specific immune response. The T cell responses to gp120 were greatly diminished in mice coimmunized with Tat as compared with mice immunized with gp120 alone. This immunosuppressive activity of Tat was not confined to viral Ag only because it also suppressed the immune response of unrelated Ag. Analysis of the cytokine profile suggests that Tat induces IL-10 and since IL-10 has been demonstrated to have appreciable T cell inhibitory activity, it is plausible that IL-10 could be responsible for Tat-mediated immunosuppression. Finally, the immunosuppressive effect of Tat was not observed in IL-10-deficient mice, confirming the role of IL-10 in Tat-mediated immunosuppression. Thus, our results demonstrate for the first time that the immunosuppressive effect of Tat is mediated through IL-10 and suggests that Tat-induced IL-10-mediated immune suppression seems to cripple immune surveillance during HIV-1 infection.

show abstract

Section: Discussionmentioning

confidence: 98%

HIV-1 Tat Suppresses gp120-Specific T Cell Response in IL-10-Dependent Manner

Gupta

Boppana

Mishra

et al. 2008

The Journal of Immunology

View full text Add to dashboard Cite

show abstract

“…[76][77][78][79] Thus far, however, there is no evidence that these processes are operative during HCV infection, or any of the other persistent hepatotropic viruses, for that matter. Interestingly, HCV core protein has been shown to interact with several cellular factors including the tumor necrosis factor receptor-related lymphotoxin-␤ receptor (LT-␤R).…”

Section: Mechanisms Potentially Involved In Viral Persistencementioning

confidence: 99%

Pathogenesis of chronic hepatitis C: Immunological features of hepatic injury and viral persistence

1999

View full text Add to dashboard Cite

The immune response to viral antigens is thought to be responsible for viral clearance and disease pathogenesis during hepatitis C virus (HCV) infection. In chronically infected patients, the T-cell response to the HCV is polyclonal and multispecific, although it is not as strong as the response in acutely infected patients who display a more vigorous T-cell response. Importantly, viral clearance in acutely infected patients is associated with a strong CD4 ؉ helper T-cell response. Thus, the dominant cause of viral persistence during HCV infection may be the development of a weak antiviral immune response to the viral antigens, with corresponding inability to eradicate infected cells. The most striking feature of hepatitis C is its tendency toward chronicity. The hepatitis C virus (HCV) contains a positive-stranded RNA genome of about 10 kilobases, which contains a single uninterrupted open reading frame that encodes a protein of 3010-3011 amino acids. 1,2 The virus is classified as a Flavivirus. HCV infects an estimated 400 million people, corresponding to more than 3% of the world population. 3 Numerous partial and complete nucleotide sequences have been derived from geographically widespread HCV isolates. The data indicate substantial sequence diversity within, and especially between, each geographic area. The European and American isolates appear to be more closely related to each other than to the Japanese isolates. Based on a polymerase chain reaction-based algorithm, a classification system has been proposed by Okamoto 4 and revised by Simmonds. 5 Different viral sequences (quasispecies) have been isolated from the same patient upon sequential sampling, and multiple isolates have been reported in a single sample. 6 The degree of similarity between isolates at the amino acid level varies from genome region to region. The nucleocapsid protein (core) has the highest sequence homology among all isolates sequenced to date. In contrast, the E1 and E2/NS1 regions present the highest degree of sequence variability among different isolates; in particular, the N terminal portion of E2/NS1 contains a hypervariable region of 30 amino acids, which shows extensive variation between virtually all known isolates. 7 The major extracellular loop of CD81, a cell-surface protein widely expressed on B and T lymphocytes and other cells including hepatocytes, has been shown to bind E2. 8 The recent success of isolating a cDNA clone capable of generating infectious RNA transcripts may be an important step toward the development of a tissue culture system. 9,10 The only animal model, the chimpanzee, mirrors several features of human HCV infection. Most importantly, the frequency of persistent infection is high in both species, and virus replication occurs despite evidence of cellular and humoral immune responses. 11,12 A key difference is that necroinflammatory lesions in chronically infected chimpanzees are almost always mild, whereas in humans, the disease spectrum is very wide, ranging from mild to severe hepatitis and end-sta...

show abstract

“…Viral cores were recovered from lysates of infected BT cells by centrifugation through a sucrosedextran cushion, and DNA was purified by standard methods (12,29). Restriction enzyme analyses, Southern blot hybridizations, PCRs, and DNA sequence determinations were performed according to standard methods (16,29). The primers used in PCRs were as follows: gf1, AGCGCCCGGGATCCATGAAG TTGCTCGTCG; gf2, ACTCGAGGTACCTAGCGGCGTCTTCTGGG; gpt, CCTGTTCAAACCCCGCTTTA; lac, GACAAACTCGGGCAGCGTT; and out, TCACCGAGGCGGAGCCGTT.…”

Section: Cells and Virusmentioning

confidence: 99%

Viral Vascular Endothelial Growth Factor Plays a Critical Role in Orf Virus Infection

Savory¹,

Stacker

Fleming³

et al. 2000

J Virol

Self Cite

123

116

View full text Add to dashboard Cite

Infection by the parapoxvirus orf virus causes proliferative skin lesions in which extensive capillary proliferation and dilation are prominent histological features. This infective phenotype may be linked to a unique virus-encoded factor, a distinctive new member of the vascular endothelial growth factor (VEGF) family of molecules. We constructed a recombinant orf virus in which the VEGF-like gene was disrupted and show that inactivation of this gene resulted in the loss of three VEGF activities expressed by the parent virus: mitogenesis of vascular endothelial cells, induction of vascular permeability, and activation of VEGF receptor 2. We used the recombinant orf virus to assess the contribution of the viral VEGF to the vascular response seen during orf virus infection of skin. Our results demonstrate that the viral VEGF, while recognizing a unique profile of the known VEGF receptors (receptor 2 and neuropilin 1), is able to stimulate a striking proliferation of blood vessels in the dermis underlying the site of infection. Furthermore, the data demonstrate that the viral VEGF participates in promoting a distinctive pattern of epidermal proliferation. Loss of a functional viral VEGF resulted in lesions with markedly reduced clinical indications of infection. However, viral replication in the early stages of infection was not impaired, and only at later times did it appear that replication of the recombinant virus might be reduced.

show abstract

Sequence and Functional Analysis of a Homolog of Interleukin-10 Encoded by the Parapoxvirus Orf Virus

Cited by 30 publications

References 61 publications

HIV-1 Tat Suppresses gp120-Specific T Cell Response in IL-10-Dependent Manner

HIV-1 Tat Suppresses gp120-Specific T Cell Response in IL-10-Dependent Manner

Pathogenesis of chronic hepatitis C: Immunological features of hepatic injury and viral persistence

Viral Vascular Endothelial Growth Factor Plays a Critical Role in Orf Virus Infection

Contact Info

Product

Resources

About