Sensitive detection of the K103N non-nucleoside reverse transcriptase inhibitor resistance mutation in treatment-naïve HIV-1 infected individuals by rolling circle amplification

Wang, Bin; Dwyer, Dominic E.; Chew, Choo Beng; Kol, Chenda; He, Zhong; Joshi, Hemal; Steain, Megan; Cunningham, Anthony L.; Saksena, Nitin K.

doi:10.1016/j.jviromet.2009.06.004

Cited by 12 publications

(3 citation statements)

References 35 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The ligation of the padlock probes to the amplified PCR products was performed according to Wang et al [20], in a total reaction volume of 10 µl containing 75 ng of amplicon, 2 U of Pfu DNA ligase (Stratagene, Integrated Sciences) and 1 pmol of the padlock probe in 20 mM Tris-HCl (pH 7.5), 20 mM KCl, 10 mM MgCl 2 , 0.1% Igepal, 0.01 mMrATP, 1 mMDTT. The ligation reaction conditions included 5 min denaturation at 94°C followed by 15 cycles of 94°C for 30 s and 4 min ligation at 65°C.…”

Section: Methodsmentioning

confidence: 99%

“…Positive results can be detected by a simple electrophoresis to visualize the presence of a ladder-like pattern of dsDNA, whereas absence of bands denote negative results due to the failure of the formation of a circular molecule after probe hybridization. HRCA has been used successfully for genotyping of human populations [19], as well as viruses and bacteria [20], [21]. Recently HRCA was also used to identify the two species C. neoformans and C. gattii and to differentiate between the serotypes A and D of C. neoformans [22], [23].…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Identification of the Major Molecular Types of Cryptococcus neoformans and C. gattii by Hyperbranched Rolling Circle Amplification

et al. 2014

Self Cite

View full text Add to dashboard Cite

The agents of cryptococcosis C. neoformans and C. gattii are important agents of meningoencephalitis in immunocompromised and immunocompetent hosts, respectively. They are grouped into eight major molecular types, VNI-VNIV for C. neoformans and VGI-VGIV for C. gattii. These major molecular types differ in their host range, epidemiology, antifungal susceptibility and geographic distribution. To enable a rapid identification of the major molecular types and potential hybrids within the two species specific probes based on the PLB1 gene in combination with hyperbranched rolling circle amplification (HRCA) were developed. HRCA was applied to 76 cryptococcal strains, 10 strains each representing the 7 haploid major molecular types, 4 VNIII hybrid strains and 2 inter-species hybrid strains. All strains were correctly identified to the major molecular type and or hybrid type using HRCA alone. To increase the sensitivity a semi-nested PCR step was developed, which will enable the identification of the molecular types/hybrids directly from clinical samples, harboring a low copy number of DNA (40 copies). Thus, HRCA based on the PLB1 locus alone and in combination with a semi-nested PCR showed to be a specific and sensitive methodology, with a great potential to be used on clinical specimens for the direct diagnosis of the agents of cryptococcosis, including hybrid strains, enabling a rapid and patient tailored treatment choice of this disease.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Identification of the Major Molecular Types of Cryptococcus neoformans and C. gattii by Hyperbranched Rolling Circle Amplification

et al. 2014

Self Cite

View full text Add to dashboard Cite

show abstract

“…Partial NA gene was amplified using the OneStep RT-PCR system (Qiagen, Hilden, Germany) with primers 5' AGACACTATCAAGAGTTGGAGAAACA 3' and 5' TGTGATTTCACTAGAATCAGG 3' according to the manufacturer's instructions. PCR products were purified and served as template for padlock probe recognition, followed by Rolling Circle Amplification (RCA) of probe signal as previously described [5,13,14]. Chromatograms, together with their sequences, were aligned with the influenza A(H1N1)pdm09 consensus sequence derived from Australian sequences submitted to the National Center for Biotechnology Information (NCBI) Influenza Virus Sequence Database (http://www.ncbi.nlm.nih.gov/genomes/FLU/) using Sequencher software (Gene Codes Corporation, Ann Arbor, USA), and were carefully examined at the location where resistance mutations have been reported.…”

Section: Genetic Analysismentioning

confidence: 99%

Frequency of oseltamivir resistance in Sydney, during the Newcastle outbreak of community transmitted oseltamivir-resistant influenza A(H1N1)pdm09 virus, Australia, June to August 2011

et al. 2012

View full text Add to dashboard Cite

Although oseltamivir-resistant pandemic influenza A(H1N1)pdm09 is uncommon in immunocompetent individuals, a recent report from Newcastle, Australia, showed the first sustained community spread, from June to August 2011, of oseltamivir-resistant influenza A(H1N1)pdm09 virus carrying the H275Y neuraminidase (NA) mutation. To determine the frequency and the extent of this viral variant spread in the nearest major city to Newcastle, we performed a sequence-based genotypic assessment on samples from 143 oseltamivir untreated and 23 oseltamivir post-treatment individuals with influenza collected contemporaneously in Sydney, 120 km southwest of Newcastle. The detection of two of 143 (1.4%) community-derived samples containing H275Y suggests a low prevalence of oseltamivir-resistant influenza A(H1N1)pdm09 virus in the general community and no convincing evidence of spread of the NA H275Y-bearing influenza A(H1N1)pdm09 virus. In oseltamivir treated patients, oseltamivir-resistant influenza A(H1N1)pdm09 virus continue to emerge with three of 23 (13%) post-treatment samples containing the H275Y mutation. The observation of signature mutations and distinct phylogenetic relationship in full-length sequences of haemagglutinin and neuraminidase genes derived from 2011 strains against 2009 strains indicates continued genetic evolution and antigenic drift of the influenza A(H1N1)pdm09 viruses circulating in Australia.

show abstract

HIVReverse Transcriptase Inhibitors

Clercq

2010

Burger's Medicinal Chemistry and Drug Discovery

View full text Add to dashboard Cite

The first antiviral compound ever shown to be active in vitro against HIV (human immunodeficiency virus) (originally referred to as HTLV‐III (human lymphotropic virus type III) and LAV‐1 (lymphadenopathy‐associated virus type 1)) was suramin; suramin was also the first antiviral found to be effective in vivo in the treatment of HIV infections. Suramin was explored as a potential strategy for the therapy of AIDS because it has been recognized as a potent inhibitor of the reverse transcriptase (RT) associated with a number of animal retroviruses. Later, it became evident that suramin primarily acts against HIV infections as an inhibitor of virus adsorption rather than an RT inhibitor.

show abstract

Sensitive detection of the K103N non-nucleoside reverse transcriptase inhibitor resistance mutation in treatment-naïve HIV-1 infected individuals by rolling circle amplification

Cited by 12 publications

References 35 publications

Identification of the Major Molecular Types of Cryptococcus neoformans and C. gattii by Hyperbranched Rolling Circle Amplification

Identification of the Major Molecular Types of Cryptococcus neoformans and C. gattii by Hyperbranched Rolling Circle Amplification

Frequency of oseltamivir resistance in Sydney, during the Newcastle outbreak of community transmitted oseltamivir-resistant influenza A(H1N1)pdm09 virus, Australia, June to August 2011

HIVReverse Transcriptase Inhibitors

Contact Info

Product

Resources

About