SENP1-mediated GATA1 deSUMOylation is critical for definitive erythropoiesis

Abstract

Small ubiquitin-like modifier (SUMO) modification of proteins (SUMOylation) and deSUMOylation have emerged as important regulatory mechanisms for protein function. SENP1 (SUMO-specific protease) deconjugates SUMOs from modified proteins. We have created SENP1 knockout (KO) mice based on a Cre-loxP system. Global deletion of SENP1 (SENP1 KO) causes anemia and embryonic lethality between embryonic day 13.5 and postnatal day 1, correlating with erythropoiesis defects in the fetal liver. Bone marrow transplantation of SENP1 KO fetal liver cells to irradiated adult recipients confers erythropoiesis defects. Protein analyses show that the GATA1 and GATA1-dependent genes are down-regulated in fetal liver of SENP1 KO mice. This down-regulation correlates with accumulation of a SUMOylated form of GATA1. We further show that SENP1 can directly deSUMOylate GATA1, regulating GATA1-dependent gene expression and erythropoiesis by in vitro assays. Moreover, we demonstrate that GATA1 SUMOylation alters its DNA binding, reducing its recruitment to the GATA1-responsive gene promoter. Collectively, we conclude that SENP1 promotes GATA1 activation and subsequent erythropoiesis by deSUMOylating GATA1.

Regulation of GATA1 levels in erythropoiesis

“…GATA1 has also been shown to undergo sumoylation in erythroid cells . Sumoylation does not appear to affect GATA1 protein levels; however its functional significance remains contradictory.…”

“…106 However, it is not presently known how the USP7-mediated GATA1 deubiquitination relates to the acetylation and phosphorylation-mediated ubiquitination of GATA1 proposed by Hernandez-Hernandez et al 94 GATA1 has also been shown to undergo sumoylation in erythroid cells. [107][108][109] Sumoylation does not appear to affect GATA1 protein levels 109 ; however its functional significance remains contradictory. One study reported that sumoylation inhibits GATA1 chromatin occupancy and transcriptional activation, 109 whereas another study suggested the opposite, in that sumoylation appeared to enhance GATA1 chromatin occupancy, subnuclear localization, and transcriptional activation of a subset of GATA1/FOG-1-dependent target genes.…”

“…[107][108][109] Sumoylation does not appear to affect GATA1 protein levels 109 ; however its functional significance remains contradictory. One study reported that sumoylation inhibits GATA1 chromatin occupancy and transcriptional activation, 109 whereas another study suggested the opposite, in that sumoylation appeared to enhance GATA1 chromatin occupancy, subnuclear localization, and transcriptional activation of a subset of GATA1/FOG-1-dependent target genes. 108 Either way, GATA1 sumoylation appears to add yet another layer to the regulation of GATA1 activity.…”

Nuclear localization of the tyrosine kinase BMX mediates VEGFR2 expression

“…The chromatin immunoprecipitation (ChIP) assay was performed as described previously . The amount of Vegfr2 gene immunoprecipitated was quantified by real‐time PCR.…”

“…The chromatin immunoprecipitation (ChIP) assay was performed as described previously. 24 The amount of Vegfr2 gene immunoprecipitated was quantified by real-time PCR. The primers were 5′ GTCCAGTTGTGTGGGGAAAT 3′ (sense) and 5′ GAGCTGGAGCCGAAACTCTA 3′ (antisense), which amplified a 169-bp region of the human Vegfr2 promoter containing Sp1 binding sites.…”