Self-assembly of the infectious bursal disease virus capsid protein, rVP2, expressed in insect cells and purification of immunogenic chimeric rVP2H particles by immobilized metal-ion affinity chromatography

Wang, Min-Ying; Kuo, Yung-Yan; Lee, Meng-Shiou; Doong, Shyue-Ru; Ho, Ji-Yi; Lee, Long-Huw

doi:10.1002/(sici)1097-0290(20000105)67:1<104::aid-bit12>3.0.co;2-i

Cited by 33 publications

(38 citation statements)

References 21 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…2D). Second, SVP, similarly to IBDV, is able to induce a high titer of neutralizing antibody (47). This is first time that a neutralizing MAb, i.e., MAbSVP-4, was generated using SVP as an antigen.…”

Section: Discussionmentioning

confidence: 90%

“…DF-1 (chicken fibroblast) cells, kindly provided by Ching-Ho Wang at the Department of Veterinary Medicine, National Taiwan University, were grown in Dulbecco's modified Eagle's medium (DMEM) containing 10% inactivated fetal calf serum. CEF cells were derived from 10-day-old embryonated eggs and grown in medium 199 (Gibco) for the propagation of IBDV P3009, a local isolate, by standard procedures (47).…”

Section: Methodsmentioning

confidence: 99%

“…Generation of a recombinant baculovirus-expressing IBDV VP2-441-formed SVP. The generation of the recombinant baculovirus-expressing VP2-441-formed SVP was done according to procedures described previously (47). Briefly, a VP2 gene fragment encoding VP2 with 441 amino acid residues (VP2-441) was generated by PCR using pBluescript-VP2 as a template (6) and a pair of primers: forward primer P4F (CGATCGCTAGCGATGACAAAC) (5Ј to 3Ј) and reverse primer 1323NH (CGAATTCCTATGCTCCTGCAATCTTCAG) (5Ј to 3Ј), respectively.…”

Section: Methodsmentioning

confidence: 99%

“…Briefly, a VP2 gene fragment encoding VP2 with 441 amino acid residues (VP2-441) was generated by PCR using pBluescript-VP2 as a template (6) and a pair of primers: forward primer P4F (CGATCGCTAGCGATGACAAAC) (5Ј to 3Ј) and reverse primer 1323NH (CGAATTCCTATGCTCCTGCAATCTTCAG) (5Ј to 3Ј), respectively. Following the standard procedures, the recombinant transfer plasmid pBB4⌬C11 was obtained by inserting the PCR-generated VP2-441 gene fragment into a transfer vector, pBlueBac4 (47), and a recombinant baculovirus was obtained by cotransfecting plasmid pBB4⌬C11 with linear Autographa californica multiple nucleopolyhedrovirus DNA into Sf9 cells as described in the manual provided by the supplier (Invitrogen). Putative recombinant baculoviruses were then plaque purified.…”

Section: Methodsmentioning

confidence: 99%

“…These MAbs were confirmed by Western blotting and also screened for their SVP binding activity by enzyme-linked immunosorbent assay (ELISA) (22). MAbs were then further characterized by virus neutralization (47) and immunoprecipitation (IP). The binding of MAbs to IBDV was examined by IP according to procedures provided by the manufacturer (Amersham Biosciences).…”

Section: Methodsmentioning

confidence: 99%

See 4 more Smart Citations

Chicken Heat Shock Protein 90 Is a Component of the Putative Cellular Receptor Complex of Infectious Bursal Disease Virus

Lin

Lai

et al. 2007

J Virol

Self Cite

View full text Add to dashboard Cite

Infectious bursal disease virus (IBDV) causes a highly contagious disease in young chicks and leads to significant economic losses in the poultry industry. The capsid protein VP2 of IBDV plays an important role in virus binding and cell recognition. VP2 forms a subviral particle (SVP) with immunogenicity similar to that of the IBDV capsid. In the present study, we first showed that SVP could inhibit IBDV infection to an IBDV-susceptible cell line, DF-1 cells, in a dose-dependent manner. Second, the localizations of the SVP on the surface of DF-1 cells were confirmed by fluorescence microscopy, and the specific binding of the SVP to DF-1 cells occurred in a dose-dependent manner. Furthermore, the attachment of SVP to DF-1 cells was inhibited by an SVP-induced neutralizing monoclonal antibody against IBDV but not by denatured-VP2-induced polyclonal antibodies. Third, the cellular factors in DF-1 cells involved in the attachment of SVP were purified by affinity chromatography using SVP bound on the immobilized Ni 2؉ ions. A dominant factor was identified as being chicken heat shock protein 90 (Hsp90) (cHsp90) by mass spectrometry. Results of biotinylation experiments and indirect fluorescence assays indicated that cHsp90 is located on the surface of DF-1 cells. Virus overlay protein binding assays and far-Western assays also concluded that cHsp90 interacts with IBDV and SVP, respectively. Finally, both Hsp90 and anti-Hsp90 can inhibit the infection of DF-1 cells by IBDV. Taken together, for the first time, our results suggest that cHsp90 is part of the putative cellular receptor complex essential for IBDV entry into DF-1 cells. Infectious bursal disease virus (IBDV), a member of genusAvibirnavirus of the family Birnaviridae, causes a highly contagious disease in young chicks (27). Two serotypes (serotypes 1 and 2) of IBDV have been documented. Serotype 1 showed different degrees of pathogenicity and mortality in chicks, and serotype 2 was avirulent. As with all viruses, IBDV needs to penetrate target cells to cause infection. Chicken B lymphocytes are the primary target for virulent serotype 1 strains of IBDV, and the infection causes a functional loss of the bursa of Fabricius and severe immunodepression. However, other susceptible cells have also been reported (17). Viral attachment is the first step in virus infection (41). The distribution of a virus receptor mainly determines the cell and tissue tropism of the virus (1, 11) and the site of pathology associated with infection (9, 26). Thus, study of virus infection at the levels of virus binding, receptor identification, and even uncoating is critical for an understanding of the virus-host cell interactions and pathogenesis of viral disease (24, 32). Additionally, viral entry and uncoating can serve as targets for the development of antiviral drugs (39,42). Recent advances in the understanding of the viral infection process have made it possible to develop new approaches to block the entry of viruses (31) and to prevent diseases (41). However, the identificatio...

show abstract

Section: Discussionmentioning

confidence: 90%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

See 3 more Smart Citations

Chicken Heat Shock Protein 90 Is a Component of the Putative Cellular Receptor Complex of Infectious Bursal Disease Virus

Lin

Lai

et al. 2007

J Virol

Self Cite

View full text Add to dashboard Cite

show abstract

Purification of Bionanoparticles

2008

View full text Add to dashboard Cite

The recent demand for nanoparticulate products such as viruses, plasmids, protein nanoparticles, and drug delivery systems have resulted in the requirement for predictable and controllable production processes. Protein nanoparticles are an attractive candidate for gene and molecular therapy due to their relatively easy production and manipulation. These particles combine the advantages of both viral and non-viral vectors while minimizing the disadvantages. However, their successful application depends on the availability of selective and scalable methodologies for product recovery and purification. Downstream processing of nanoparticles depends on the production process, producer system, culture media and on the structural nature of the assembled nanoparticle, i.e., mainly size, shape and architecture. In this paper, the most common processes currently used for the purification of nanoparticles, are reviewed.

show abstract

Synthetic Receptors for the Differentiation of Phosphorylated Peptides with Nanomolar Affinities

Grauer

Riechers

Ritter

et al. 2008

Chemistry A European J

View full text Add to dashboard Cite

Artificial ditopic receptors for the differentiation of phosphorylated peptides varying in i+3 amino acid side chains were synthesized, and their binding affinities and selectivities were determined. The synthetic receptors show the highest binding affinities to phosphorylated peptides under physiological conditions (HEPES, pH 7.5, 154 mM NaCl) reported thus far for artificial systems. The tight and selective binding was achieved by high cooperativity of the two binding moieties in the receptor molecules. All receptors interact with phosphorylated serine by bis(ZnII-cyclen) complex coordination and a second binding site recognizing a carboxylate or imidazole amino acid side chain functionality.

show abstract

Self-assembly of the infectious bursal disease virus capsid protein, rVP2, expressed in insect cells and purification of immunogenic chimeric rVP2H particles by immobilized metal-ion affinity chromatography

Cited by 33 publications

References 21 publications

Chicken Heat Shock Protein 90 Is a Component of the Putative Cellular Receptor Complex of Infectious Bursal Disease Virus

Chicken Heat Shock Protein 90 Is a Component of the Putative Cellular Receptor Complex of Infectious Bursal Disease Virus

Purification of Bionanoparticles

Synthetic Receptors for the Differentiation of Phosphorylated Peptides with Nanomolar Affinities

Contact Info

Product

Resources

About