Selective Suppression of the Splicing-Mediated MicroRNA Pathway by the Terminal Uridyltransferase Tailor

Abstract

Summary Several terminal uridyltransferases (TUTases) are known to modulate small RNA biogenesis and/or function via diverse mechanisms. Here, we demonstrate that Drosophila splicing-derived pre-miRNAs (mirtrons) are efficiently modified by the previously uncharacterized TUTase, Tailor. Tailor is necessary and sufficient for mirtron hairpin uridylation, and this modification inhibits mirtron biogenesis. Genomewide analyses demonstrate that mirtrons are dominant Tailor substrates, and three features contribute to substrate specificity. First, reprogramming experiments show Tailor preferentially identifies splicing-derived miRNAs. Second, in vitro tests indicate Tailor prefers substrate hairpins over mature miRNAs. Third, Tailor exhibit sequence preference for 3′-terminal AG, a defining mirtron characteristic. Our work supports that Tailor preferentially suppresses biogenesis of mirtrons, an evolutionarily adventitious pre-miRNA substrate class. Moreover, we detect preferential activity of Tailor on 3′-G canonical pre-miRNAs, and specific depletion of such loci from the pool of conserved miRNAs. Thus, Tailor activity may have had collateral impact on shaping populations of canonical miRNAs.

Uridylation and adenylation of RNAs

“…For example, miRNA 3′ uridylation and adenylation exhibit sequence specificity—some miRNAs are predominantly adenylated while others are predominantly uridylated [79,88]. This is consistent with the fact that some nucleotidyl transferases (such as Arabidopsis URT1 and HESO1 and Drosophila Tailor) exhibit a preference for the 3′ nucleotide in its substrate RNA [55,72,73] (Table 1 and Figure 2). RNA-binding proteins also contribute to the recruitment of nucleotidyl transferases to specific substrates as discussed above [62,64].…”

“…High throughput sequencing revealed that mirtron pre-miRNAs, which are generated from intron splicing rather than Drosha processing, are preferentially uridylated as compared to canonical pre-miRNAs [70,71]. Two recent studies identified the Drosophila nucleotidyl transferase Tailor as the enzyme that uridylates mirtron pre-miRNAs [72,73]. The specificity of Tailor for mirtron pre-miRNAs could be explained by the preference for a 3′ G in the substrate RNA by this enzyme, as introns released from splicing should end with a 3′G [72,73] (Table 1).…”

“…Two recent studies identified the Drosophila nucleotidyl transferase Tailor as the enzyme that uridylates mirtron pre-miRNAs [72,73]. The specificity of Tailor for mirtron pre-miRNAs could be explained by the preference for a 3′ G in the substrate RNA by this enzyme, as introns released from splicing should end with a 3′G [72,73] (Table 1). …”

The Drosophila Dicer-1 Partner Loquacious Enhances miRNA Processing from Hairpins with Unstable Structures at the Dicing Site

“…Indeed, organisms are equipped with mechanisms suppressing excessive emergence of active miRNA genes produced via the mirtron pathway (Bortolamiol-Becet et al, 2015; Reimao-Pinto et al, 2015). On the other hand, the miRNA pathway has to be flexible enough to support the emergence of beneficial genes as well.…”

Alternative splicing of a viral mirtron differentially affects the expression of other microRNAs from its cluster and of the host transcript

“…In addition, a global analysis of miRNA deep sequencing data from MSB-1 cells revealed that a non-negligible part of the reads for the mdv1-miR-M6-3P sequence corresponded to 3SS splicing of the mirtron (GAGAUCCCUGCGAAAUGACAG), and almost all the other reads ended with a uracil residue (GAGAUCC-CUGCGAAAUGACAGU), as annotated in miRbase ((http:// www.mirbase.org/). 23 This last uracil residue probably results from the classical 3 0 -monouridylation generally observed for 5 0 -tailed mirtrons, [30][31][32] but it may also be the signature from the genomic sequence of mdv1-mir-M6 cropping by Drosha, as confirmed by sequencing analyses of specific 5 0 RACE-PCR (Invitrogen) on non-capped RNAs from MSB-1 cells (data not shown).…”