Selective detection of human papilloma virus DNAs by specific synthetic DNA probes

Cravador, A.; Herzog, Albert; Houard, Sophie; d'Ippolito, Pierre; Carroll, Ruba; Bollen, Alex

doi:10.1016/0890-8508(89)90025-x

Cited by 10 publications

(1 citation statement)

References 67 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…For PCR-EIA, two sets of oligonucleotide primers were synthesized by the methoxyphosphoramidite method on a DNA synthesizer: an outer set to amplify HPV-16 DNA in specimens and a nested set to generate the RNA probe. The primers were selected from a region of the E7 and E l a genes of HPV-16 that shows low homology with genomes of other HPV types and is not known to be disrupted when the HPV genome integrates into host cellular DNA [Baker et al, 1987;Cole and Danos, 1987;Cravador et al, 1989;Petterson et al, 1987;Schneider-Manoury et al, 1987;Seedorf et al, 19851. Locations on the HPV-16 genome of the outer set of primers were: 0-1: bp 673-697: ATAGATGGTCCAGCTGGACAAGCAG, 0-2: bp 985-1009: CCAAATCTTCACCTGTATCACTGTC.…”

Section: Polymerase Chain Reaction-enzymementioning

confidence: 99%

Detection of HPV‐16 in cell lines and cervical lavage specimens by a polymerase chain reaction‐enzyme immunoassay assay

Coutlée

Bobo²,

Abbass

et al. 1992

Journal of Medical Virology

View full text Add to dashboard Cite

A gene amplification method that combines the polymerase chain reaction with detection of amplified DNA in a solution hybridization/enzyme immunoassay (PCR-EIA) was developed for HPV-16 DNA. Samples were amplified with primers for the E7-E1 region of HPV-16. Amplified DNA products were identified and quantitated by hybridization in solution with a biotinylated RNA probe. Labeled DNA/RNA hybrids were measured semiquantitatively in an enzyme immunoassay using solid phase anti-biotin antibody and liquid phase B-d-galactosidase labeled monoclonal antibody against DNA-RNA hybrids. Enzyme bound to the solid phase was quantitated with a fluorogenic substrate. The assay was linear over 2 log10 dilutions of SiHa cells and the detection limit was three copies of HPV-16 genome. The sensitivity of PCR-EIA for detection of PCR amplified products compared favorably with slot and Southern blots using a 32P-labeled RNA probe. The assay was used to assess HPV-16 infection of uterine cervix in women attending a clinic for sexually transmitted diseases. Twenty-one of the 81 specimens (25.9%), obtained by cervicovaginal lavage, were positive for HPV-16 by PCR-EIA. The assay provides a convenient means to objectively measure HPV DNA amplified with PCR.

show abstract