Selection of a nonconsensus branch point is influenced by an RNA stem-loop structure and is important to confer stability to the herpes simplex virus 2-kilobase latency-associated transcript

Abstract

Herpes simplex virus type 1 latent infection in sensory neurons is characterized by the highly restricted transcription of viral genes. The latency-associated transcripts (LAT) family members are the only transcripts that can be identified in large amounts in latently infected cells. The most abundant LAT species is a 2-kb RNA that results from splicing of a rare primary transcript. Analysis of a LAT mutant virus (TB1) in cell culture revealed an aberrant splicing pattern and production of a stable small (0.95-kb) LAT intron. A panel of deletion constructs expressing truncated LAT in transiently transfected cells mapped the region influencing stability to the 3 end of the LAT intron. This region encompasses the branch point and a putative stable stem-loop hairpin structure immediately upstream of the splice acceptor consensus polypyrimidine tract. Mutagenic analysis of the sequence in this region confirmed our hypothesis that the stem-loop structure is important for efficient splicing by influencing the selection of a nonconsensus branch point. Changes in this structure correlate with changes in branch point selection and production of an unstable 2-kb LAT. Cells and virus.Cos-1 cells were grown in Iscove's medium supplemented with 5% calf serum. CV-1 cells were maintained in Eagle's minimal essential medium plus 5% calf serum. HSV-1 mutant TB1 and HSV-1 F were prepared as previously described (4,9,10).Plasmid construction. The 2.8-kb PstI-MluI restriction fragment encompassing the LAT gene of HSV-1 F was subcloned into the EcoRI and HindIII sites of pcDNA3 (Invitrogen) as described previously (58). The resulting plasmid, pcDNA3Pst-Mlu, served as the backbone for subsequent mutations and will be referred as the wild-type (wt) plasmid. Mutants p⌬Hpa and p⌬Xcm were generated by removal of the corresponding restriction fragment and self-ligation (prior Klenow filling in was necessary in the case of p⌬Xcm). To construct p⌬Bfa, the 2.8-kb EcoRI-HindIII fragment from pcDNA3Pst-Mlu was isolated and digested with BfaI. The resulting 2,110-bp HindIII-BfaI and 400-bp BfaI-EcoRI fragments were purified and ligated directly in the EcoRI-indIII-digested wt vector. Plasmids pHϩ and pHϪ were generated by the insertion in p⌬Hpa of the 440-bp HpaI fragment consisting of lambda phage DNA from plasmid pNF1. In pHϪ, the phage DNA insert is in the same orientation as in the TB1 virus; it is in the opposite orientation in pHϩ.The pBam clone was generated by site-directed mutagenesis (23) to create a unique BamHI site toward the 3Ј end of the 2-kb LAT. Fragments from pcDNA3Pst-Mlu were amplified by PCR with primers PFPML (GGGGCATC ACGTGGTTACCC) and PRBAM (GAGACAAGAGGAAGGATCCCTCG GC) or with PFBH1 (AGGGATCCTTCCTCTTGTCTCCCTCCCAGG) and PRP31 (GCCAGTGTGATGGATATCTGC). Both amplified products were purified from agarose gels and mixed equally in a second PCR with PFPML and PRP31 as amplification primers. The 700-bp final product was digested with EcoRI and BbrPI (PmlI) and cloned into the corresponding sites of vector pcDNA3Pst-Mlu. Following...

Genetic Studies Exposing the Splicing Events Involved in Herpes Simplex Virus Type 1 Latency-Associated Transcript Production during Lytic and Latent Infection

“…This demonstrated that the outer splice sites are normally active in lytic and latent infection, which supports the interpretation of our mutational studies that our splice site mutations abolished LAT expression by disrupting normal splicing. Using other primer pairs, we have also amplified and sequenced additional splice junctions from latent infections, demonstrating the mixed pairing of outer and inner splice sites of opposite polarity (data not shown) and identifying a minor splice acceptor previously observed in transient transfection studies with a LAT minigene (37) (Fig. 5B).…”

“…Considerable evidence now exists that lytic 2-kb LAT is a lariat-shaped molecule, as expected for an excised intron (46,68). However, most excised introns are rapidly degraded while the LATs are stable (37,46). It has been shown by hybridization with short oligonucleotide probes that the 2-kb LAT does not extend fully to the external splice acceptor site (46,52,68), suggesting that this excised intron is targeted by a 3Ј-exonucleolytic activity like most excised introns, but that this activity encounters a barrier just inside the intron.…”

“…Other observations supporting a splicing model for LAT production are the demonstration that the LATs are neither capped nor polyadenylated (13), in contrast to mLAT, that their shared coding sequences are flanked by canonical splice site signals, that their 5Ј ends map almost precisely to the predicted splice donor site (52,62), and that they are nonlinear molecules with characteristics typical of the branched intron products (lariats) of conventional pre-mRNA splicing (reviewed in references 4 and 19). In addition, studies using LAT minigene constructs and lacZ/LAT chimeric constructs have shown that both 2-kb LAT and an exonic product spliced at the canonical splice sites are generated in transiently transfected cells, demonstrating that these canonical sites are functional (18,37). It has also been reported that 2-and 1.5-kb LATs were produced from a lacZ/LAT vector during latency, although it was not demonstrated that these LATs were produced by splicing (59).…”

“…However, other observations are less supportive of a splicing mechanism. For example, both the stability of the major LATs (37,46) and their presence in the polyribosomal RNA fraction of transfected (25,70) and infected (25,26,42) cells are highly unusual for excised introns, the predicted exonic splicing product (spliced mLAT) is not readily detectable, and the 3Ј ends of the LATs appear to map somewhat upstream of the predicted splice acceptor site rather than to the site itself (46,52,68). To reconcile these divergent observations with a splicing mechanism, it has been proposed that (i) spliced mLAT is highly unstable and (ii) the excised introns (i.e., the mature LATs) are stable lariats trimmed by a 3Ј-exonucleolytic activity up to a structural block variously suggested to be the branch point itself or a stable stem-loop structure that may form near the end of the intron (37,46,68,70).…”

The molecular basis of herpes simplex virus latency

“…The nomenclature of these RNAs reflects their abundance and ease of detection within experimental systems. The inefficiently debranched stable lariat structure of the major LATs produced during splicing probably explains their abundance (Farrell et al ., ; Wu et al ., , ; Krummenacher et al ., ; Rødahl & Haarr, ). In contrast, the 8.3 kb minor LAT transcript and its 6.3 kb exon are difficult to reliably detect without more sensitive in situ hybridization (ISH) or RT‐PCR methods (Rock et al ., ; Deatly et al ., ; Zwaagstra et al ., ; Devi‐Rao et al ., ; Arthur et al ., ).…”