Selection and use of reference genes in mouse mammary glands

Abstract

ABSTRACT. Obtaining quantitative data concerning gene expression is important for understanding milk synthesis in mammary glands. Quantitative real-time PCR (qRT-PCR) is an efficient tool to calculate gene expression; however, it is necessary to find valid reference genes for normalization of qRT-PCR data. We applied the geNorm software to eight commonly used reference genes to identify the most stable and optimal genes for the mouse mammary gland. Based on this analysis, HPRT, RPL and GAPDH are the most appropriate reference genes for data normalization. We tested the expression of the α-lactalbumin and fatty acid synthase genes using these three reference genes, both normalized and non-normalized. The normalized mRNA expression ratio was significantly different from the non-normalized ratio. We recommend the use of these three reference genes for the normalization of qRT-PCR data in gene expression studies of mouse mammary glands.

Parity induces differentiation and reduces Wnt/Notch signaling ratio and proliferation potential of basal stem/progenitor cells isolated from mouse mammary epithelium

“…In all cases, fold changes are shown relative to cells from age-matched virgin control mice. Ct values were normalized to the reference genes Hprt and Ubc [63]. Data represent the mean ± SEM of three independent experiments with 10 mice (five virgins; five parous) per experiment.…”

T‐type calcium channel blockade improves survival and cardiovascular function in thalassemic mice

“…The cycling conditions included in a hot start at 95°C for 30 s, followed by 45 cycles at 95°C for 5 s, and 60°C for 10 s. To detect LTCC, TTCC and glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) mRNA expression, the gene‐specific primers for these genes were used. Sense and antisense primers (10 n m ) were forward (F) 5′‐TCTGCCTCTCTAGGTCGAA‐3′ and reverse (R) 5′‐GGGAATGTGGTAGGAGAATG‐3′ for LTCC(α1C) (38), forward (F) 5′‐TGTGGAAATGGTGGTGAAGA‐3′ and reverse (R) 5′‐ACTGCGGAGAAGCTGACATT‐3′ for TTCC(α1G) (38), forward (F) 5′‐TGTGTCCGTCGTGGATCTGA‐3′ and reverse (R) 5′‐TTGCTGTTGAAGTCGCAGGAG‐3′ for GAPDH (39). The fluorescent amplification curve of the product was determined, and the cycle at which the fluorescence reached a threshold was recorded ( C t ) in triplicate and averaged.…”

Staphylococcus aureus and Lipopolysaccharide Modulate Gene Expressions of Drug Transporters in Mouse Mammary Epithelial Cells Correlation to Inflammatory Biomarkers

“…Expressions of target genes were normalized to the geometric average expression of three appropriate reference genes [42]. We used the three reference genes, recommended for normalization of RT-qPCR data in gene expression studies of mouse mammary gland: hypoxanthine-guanine phosphoribosyltransferase ( Hprt ), ribosomal protein L13A ( Rpl13a ) and glyceraldehyde 3-phosphate dehydrogenase ( Gapdh ) [43]. Relative quantification of mRNA expressions was performed by comparing the quantification cycle (Cq) between the tissues and treatment groups of cells according to the 2 -(ΔΔCq) –method [44].…”