Screening Peptide/Protein Libraries Fused to the λ Repressor DNA-Binding Domain in E. coli Cells

Mariño-Ramírez, Leonardo; Campbell, Lisa; Hu, James C.

doi:10.1385/1-59259-301-1:235

Cited by 8 publications

(9 citation statements)

References 22 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…To reinforce the identification of genes, an IST library was constructed. These libraries are based on the ability of expressed fusion proteins consisting of the Nterminal DNA-binding domain of the CI repressor and sequences encoded by randomly cloned fragments from the target genome to reconstitute repressor function (40). As CI requires separate DNA-binding and dimerization domains, immunity is conferred when the fragment of target DNA is in frame with CI and encodes a stretch of amino acid residues capable of homotypic interactions.…”

Section: Resultsmentioning

confidence: 99%

Divergence and Mosaicism among Virulent Soil Phages of the Burkholderia cepacia Complex

et al. 2006

View full text Add to dashboard Cite

We have determined the genomic sequences of four virulent myophages, Bcep1, Bcep43, BcepB1A, and Bcep781, whose hosts are soil isolates of the Burkholderia cepacia complex. Despite temporal and spatial separations between initial isolations, three of the phages (Bcep1, Bcep43, and Bcep781, designated the Bcep781 group) exhibit 87% to 99% sequence identity to one another and most coding region differences are due to synonymous nucleotide substitutions, a hallmark of neutral genetic drift. Phage BcepB1A has a very different genome organization but is clearly a mosaic with respect to many of the genes of the Bcep781 group, as is a defective prophage element in Photorhabdus luminescens. Functions were assigned to 27 out of 71 predicted genes of Bcep1 despite extreme sequence divergence. Using a lambda repressor fusion technique, 10 Bcep781-encoded proteins were identified for their ability to support homotypic interactions. While head and tail morphogenesis genes have retained canonical gene order despite extreme sequence divergence, genes involved in DNA metabolism and host lysis are not organized as in other phages. This unusual genome arrangement may contribute to the ability of the Bcep781-like phages to maintain a unified genomic type. However, the Bcep781 group phages can also engage in lateral gene transfer events with otherwise unrelated phages, a process that contributes to the broader-scale genomic mosaicism prevalent among the tailed phages.

show abstract

Section: Resultsmentioning

confidence: 99%

Divergence and Mosaicism among Virulent Soil Phages of the Burkholderia cepacia Complex

et al. 2006

View full text Add to dashboard Cite

show abstract

“…The plasmids used for expression of cI included pFG157, which expresses full-length cI; pKH101, which expresses the DNA binding domain (DBD) of cI; and pJH370, which expresses a fusion between cI DBD and the leucine zipper of GCN4 (22,23). Plasmid pGB17 expresses cI DBD -Rns(1-154)-FLAG and was constructed by amplifying a fragment of rns from pGPMRns with primers SalIRnsfor (AGTCAGGTCGACGATGGACTTTAAATAC) and RnsFlagBamrv3 (ACGGATCCTACTTGTCATCGTCGTCCTTGTAGTCAATTGATTCTAT), which added a FLAG epitope tag after codon 154 of rns.…”

Section: Methodsmentioning

confidence: 99%

Residues near the Amino Terminus of Rns Are Essential for Positive Autoregulation and DNA Binding

et al. 2008

View full text Add to dashboard Cite

Most members of the AraC/XylS family contain a conserved carboxy-terminal DNA binding domain and a less conserved amino-terminal domain involved in binding small-molecule effectors and dimerization. However, there is no evidence that Rns, a regulator of enterotoxigenic Escherichia coli virulence genes, responds to an effector ligand, and in this study we found that the amino-terminal domain of Rns does not form homodimers in vivo. Exposure of Rns to the chemical cross-linker glutaraldehyde revealed that the full-length protein is also a monomer in vitro. Nevertheless, deletion analysis of Rns demonstrated that the first 60 amino acids of the protein are essential for the activation and repression of Rns-regulated promoters in vivo. Amino-terminal truncation of Rns abolished DNA binding in vitro, and two randomly generated mutations, I14T and N16D, that independently abolished Rns autoregulation were isolated. Further analysis of these mutations revealed that they have disparate effects at other Rns-regulated promoters and suggest that they may be involved in an interaction with the carboxy-terminal domain of Rns. Thus, evolution may have preserved the amino terminus of Rns because it is essential for the regulator's activity even though it apparently lacks the two functions, dimerization and ligand binding, usually associated with the amino-terminal domains of AraC/XylS family members.

show abstract

“…AF308740), and pLM101 (GenBank accession no. AF308741) (35)(36)(37). These vectors contain an amber mutation at codon 103 of the cI segment, between the DNA-binding domain and the DNA insert, which is used for screening for insert dependence (see below).…”

Section: Methodsmentioning

confidence: 99%

“…The plates were incubated at 37°C overnight, and survivors were picked into 96-well plates for further analysis. We performed insert dependence tests as described previously (35)(36)(37) for the EB099, EB100, and EB101 libraries and found that all of the survivors were insert dependent, as judged by the dependence of repressor function on an amber suppressor that allows translation of the insert. Therefore, the other libraries were not evaluated for insert dependence.…”

Section: Methodsmentioning

confidence: 99%

Identification and Mapping of Self-Assembling Protein Domains Encoded by theEscherichia coliK-12 Genome by Use of λ Repressor Fusions

et al. 2004

Self Cite

View full text Add to dashboard Cite

Self-assembling proteins and protein fragments encoded by the Escherichia coli genome were identified from E. coli K-12 strain MG1655. Libraries of random DNA fragments cloned into a series of repressor fusion vectors were subjected to selection for immunity to infection by phage . Survivors were identified by sequencing the ends of the inserts, and the fused protein sequence was inferred from the known genomic sequence. Four hundred sixty-three nonredundant open reading frame-encoded interacting sequence tags (ISTs) were recovered from sequencing 2,089 candidates. These ISTs, which range from 16 to 794 amino acids in length, were clustered into families of overlapping fragments, identifying potential homotypic interactions encoded by 232 E. coli genes. Repressor fusions identified ISTs from genes in every protein-based functional category, but membrane proteins were underrepresented. The IST-containing genes were enriched for regulatory proteins and for proteins that form higher-order oligomers. Forty-eight (20.7%) homotypic proteins identified by ISTs are predicted to contain coiled coils. Although most of the IST-containing genes are identifiably related to proteins in other bacterial genomes, more than half of the ISTs do not have identifiable homologs in the Protein Data Bank, suggesting that they may include many novel structures. The data are available online at http://oligomers.tamu.edu/.For many proteins, quaternary structure is intimately coupled to function and stability. This coupling allows the regulation of many cellular processes to be controlled through specific assembly or disassembly of protein complexes as well as by conformational changes that alter how subunits contact one another.Proteins use a wide variety of quaternary structures to assemble multisubunit complexes. Genome-wide identification of protein interactions by use of genetic (21,36,46,57,58) or biochemical (15,19,41) screens has provided a wealth of insight into the diversity of structures used for self-assembly. In the annotation of predicted open reading frames (ORFs), assembly interactions are an important feature that provides insights into structure and function. In addition, the involvement of a gene product in a multimeric complex suggests strategies for the generation of assembly-based inhibitors for functional studies (18). The possibility that protein interactions represent a large and largely underexploited target for drug discovery has also been discussed (6,55) The study of the protein interactome has focused on heterotypic interactions, as these can provide links between proteins of unknown function and proteins of known function. However, homotypic interactions, which are found in both homomultimeric proteins and as subcomplexes of heteromultimeric proteins, may be the most common way to form protein complexes in nature (31). Although by definition self-interaction does not link a protein's function to that of another protein, homotypic interactions are important in the study of protein structure, function, and evol...

show abstract

Screening Peptide/Protein Libraries Fused to the λ Repressor DNA-Binding Domain in E. coli Cells

Cited by 8 publications

References 22 publications

Divergence and Mosaicism among Virulent Soil Phages of the Burkholderia cepacia Complex

Divergence and Mosaicism among Virulent Soil Phages of the Burkholderia cepacia Complex

Residues near the Amino Terminus of Rns Are Essential for Positive Autoregulation and DNA Binding

Identification and Mapping of Self-Assembling Protein Domains Encoded by theEscherichia coliK-12 Genome by Use of λ Repressor Fusions

Contact Info

Product

Resources

About