Screening of Pleural Mesotheliomas for DNA-damage Repair Players by Digital Gene Expression Analysis Can Enhance Clinical Management of Patients Receiving Platin-Based Chemotherapy

Abstract

Background: Malignant pleural mesothelioma (MPM) is a rare, predominantly asbestos-related and biologically highly aggressive tumour leading to a dismal prognosis. Multimodality therapy consisting of platinum-based chemotherapy is the treatment of choice. The reasons for the rather poor efficacy of platinum compounds remain largely unknown.Material and Methods: For this exploratory mRNA study, 24 FFPE tumour specimens were screened by digital gene expression analysis. Based on data from preliminary experiments and recent literature, a total of 366 mRNAs were investigated using a Custom CodeSet from NanoString. All statistical analyses were calculated with the R i386 statistical programming environment.Results: CDC25A and PARP1 gene expression were correlated with lymph node spread, BRCA1 and TP73 expression levels with higher IMIG stage. NTHL1 and XRCC3 expression was associated with TNM stage. CHECK1 as well as XRCC2 expression levels were correlated with tumour progression in the overall cohort of patients. CDKN2A and MLH1 gene expression influenced overall survival in this collective. In the adjuvant treated cohort only, CDKN2A, CHEK1 as well as ERCC1 were significantly associated with overall survival. Furthermore, TP73 expression was associated with progression in this subgroup.Conclusion: DNA-damage response plays a crucial role in response to platin-based chemotherapeutic regimes. In particular, CHEK1, XRCC2 and TP73 are strongly associated with tumour progression. ERCC1, MLH1, CDKN2A and most promising CHEK1 are prognostic markers for OS in MPM. TP73, CDKN2A, CHEK1 and ERCC1 seem to be also predictive markers in adjuvant treated MPMs. After a prospective validation, these markers may improve clinical and pathological practice, finally leading to a patients' benefit by an enhanced clinical management.

PARP‐1 regulates DNA repair factor availability

“…Additionally, these observations align with studies demonstrating that PARP‐1 and PAR are elevated in PCa compared to benign prostatic hyperplasia in a Chinese cohort (Wu et al , ) and that PARP‐1 protein is elevated in cases of primary PCa as compared to normal controls (Salemi et al , ). In other tumor types, elevated PARP‐1 mRNA is associated with poor prognosis in gliomas (Li et al , ), PARP‐1 mRNA is elevated in colon carcinoma when compared to adenoma (Dziaman et al , ), PARP‐1 gene expression is associated with lymph node spread of malignant pleural mesothelioma (Walter et al , ), and PARP‐1 mRNA and protein are elevated in endometrial adenocarcinoma (Bi et al , ). Both PARP‐1 mRNA and protein are highly expressed in small cell lung cancer (Byers et al , ), but PARP‐1 protein has been shown to associate with longer PFS in limited‐stage small cell lung cancer (Kim et al , ).…”

BRCA1 alterations with additional defects in DNA damage response genes may confer chemoresistance to BRCA‐like breast cancers treated with neoadjuvant chemotherapy

“…The methylation status of the BRCA1 promoter was examined in 73 breast cancer samples by quantitative MSP using Light Cycler (Roche Diagnostics, Indianapolis, IN). The primers and probes designed to amplify specifically the promoter region of BRCA1 or the reference gene, ACTB , were as follows; BRCA1 : 5′‐TTTCGTGGTAACGGAAAAGCG‐3′, 5′‐CCGTCCAAAAAATCTCAACGAA‐3′, and 5′‐FAM‐CTCACGCCGCGCCAATCGCAATTT‐BHQ1‐3′; ACTB : 5′‐TGGTGATGGAGGAGGTTTAGTAAGT‐3′, 5′‐AACCAATAAAACCTACTCCTCCCTTAA‐3′, and 5′‐FAM‐TGTGTTTGTTATTGTGTGTTGGGTGGTGGT‐ BHQ1‐3′ . Each amplification reaction included tumor DNA samples, methylated [CpGgenome™ Universal Methylated DNA (Chemicon International, Temecula, CA)] and unmethylated (normal lymphocyte DNA) controls treated with sodium bisulfite, and a water blank.…”

“…ACTB was used as a reference gene to evaluate the relative level of methylated DNA for BRCA1 in each sample. The percentage of BRCA1 methylation was calculated as described previously …”

“…Forty-one genes, including two principal DDR genes (BRCA1 and BRCA2), 37 additional DDR genes (FANCD2, BAP1, ATR, RAD17, XRCC4, RAD50, RAP80, FANCE, MLL3/XRCC2/PTIP, WRN, NBS1, PTEN, FANCF, MRE11A, ATM, CHEK1, FANCM, RAD51B, XRCC3, RAD51, TP53BP1, MRG15/BLM, ERCC4, PALB2, PAGR1, FANCA, RAD51D, CDK12, RAD51C, BRIP1, MLL4, ERCC1/2, and CHEK2), two oncogenes (MYC and CCNE1), and one checkpoint and apoptosis gene (TP53) were selected to analyze genomic aberrations (gains, amplifications, losses, and UPDs) because previous studies reported the involvement of these genes in the DDR pathway or genomic instabilities. 1,3,8,9,[19][20][21][22][23][24][25][26] The numbers of the four chromosome aberrations (gains, losses, amplifications, and UPDs) were examined in each tumor. Gains and amplifications in two oncogenes (MYC and CCNE1) were individually analyzed; however, they were combined and referred to as amplifications in subsequent sections.…”

Overexpressed genes in malignant pleural mesothelioma: implications in clinical management

“…CHEK1 expression in MPM samples has been found correlated with tumour progression (P=0.0362) and appear to be a predictive marker for platin-response in the adjuvanttreated patients, showing a significant correlation to the overall survival (P=0.0162) (79). Moreover CHEK1 expression seems to be involved in chemoresistance (113): loss of CHEK1 enhances camptotecins toxicity and sensitized mesothelioma cell-lines for pemetrexed (114) suggesting that CHEK1 could be a putative co-drug target for mesothelioma (9).…”