SC75741 antagonizes vesicular stomatitis virus, duck Tembusu virus, and duck plague virus infection in duck cells through promoting innate immune responses

Abstract

Duck Tembusu virus ( DTMUV ) and duck plague virus ( DPV ) are typical DNA and RNA viruses of waterfowl, causing drastic economic losses to the duck farm industry in terms of high mortality and decreased egg production. These 2 viruses reappear from time to time because the available vaccines fail to provide complete immunity and no clinical antiviral drugs are available for them. In the present study, we evaluated the antiviral activity of SC75741 for DTMUV, DPV, and the model virus, vesicular stomatitis virus infection in duck cells. SC75741, a nuclear factor-kappa B ( NF-κB )-specific inhibitor in mammal cells, revealed the highest antiviral activity among the inhibitors specific to c-Jun NH 2 -terminal kinase, extracellular signal-regulated kinase, p38 mitogen-activated protein kinase (p38), and NF-κB signaling. The antiviral activity of SC75741 was dose-dependent and showed effects in different duck cell types. Time-addition and duration assay demonstrated that SC75741 inhibited virus infection in the middle of and after virus infection at least for 72 h in duck embro fibroblast cells. The DPV viral adsorption and genomic copy number were reduced, indicating that SC75741 blocks the phase of the virus life cycle at viral entry and genomic replication. In addition, SC75741 enhanced the expression of interferon only when stimulator of interferon genes ( STING ) was overexpressed or pre-activated by the virus infection, suggesting that SC75741 acts as a STING agonist. In conclusion, SC75741 is a candidate antiviral agent for DTMUV and DPV.

A Comparative Transcriptomic Analysis Reveals That HSP90AB1 Is Involved in the Immune and Inflammatory Responses to Porcine Deltacoronavirus Infection

“…Further, we also found HSP90AB1 knockout resulted in the upregulation of NFKBIA caused by PDCoV infection was enhanced and led to a reduction of NFKBIA, NFKBIB and NKAP mRNA levels ( Figure 9 ), indicating that the effect of HSP90AB1 on PDCoV infection might be related to the NF-κB signaling pathway. Previous research has also reported that the NF-κB signaling pathway might be a suitable target for antiviral intervention, and inhibition of this signaling pathway by suppressing NF-κB activity might result in a reduction in virus infection [ 54 ]. In our study, the NF-κB inhibitors, JSH-23, SC75741 and QNZ, reduced PDCoV infection at the mRNA and protein levels ( Figure 10 ), similar to previous results obtained for some other viruses, such as avian influenza A viruses (IAVs) [ 55 ], severe fever with thrombocytopenia syndrome virus (SFTSV) and heartland virus (HRTV) [ 56 ].…”

BX795, a kinase inhibitor, inhibit duck plague virus infection via targeting US3 kinase

“…The viral genome copy number was quantified using an absolute quantitative PCR ( Q-PCR ). The quantitative primers for the detection of DPV UL30 gene were previously designed in our laboratory ( Tian et al, 2021 ), DPV UL30-F: TTTCCTCCTCCTCGCTGAGTG, and DPV UL30-R: CCAGAAACATACTGTGAGAGT. The PCR amplification conditions are as follows: 95°C for 30 s, followed by 40 cycles at 95°C for 5 s and 60°C for 30 s. Then, the PCR products were determined by the standard curve previously established in the laboratory.…”

Duck Plague Virus Negatively Regulates IFN Signaling to Promote Virus Proliferation via JNK Signaling Pathway

“…All RNA samples’ purity was detected by analyzing the A260/A280 ration using a Nano drop ND-1000spectrophotometer (Nano drop Technologies), which was expected to be 1.8~2.0. Total RNAs were reverse transcribed into cDNA with the ReverTra Ace qPCR RT Kit (Toyobo, Osaka, Japan); RT-qPCR was performed primarily according to a previous method ( 21 ). Target genes were detected using the previously described primers.…”