Salt bridge exchange binding mechanism between streptavidin and its DNA aptamer – thermodynamics and spectroscopic evidences

Abstract

Protein-nucleic acids binding driven by electrostatic interactions typically are characterized by the release of counter ions, and the salt-inhibited binding association constant (K(a)) and the magnitude of exothermic binding enthalpy (ΔH). Here, we report a non-classical thermodynamics of streptavidin (SA)-aptamer binding in NaCl (140-350 mM) solutions near room temperatures (23-27 °C). By using isothermal titration calorimetry (ITC) and circular dichroism (CD)/fluorescence spectroscopy, we found that the binding was enthalpy driven with a large entropy cost (ΔH -20.58 kcal mol(-1), TΔS -10.99 kcal mol(-1), and K(a) 1.08 × 10(7) M(-1) at 140 mM NaCl 25 °C). With the raise of salt concentrations, the ΔH became more exothermic, yet the K(a) was almost unchanged (ΔH -26.29 kcal mol(-1) and K(a) 1.50 × 10(7) M(-1) at 350 mM NaCl 25 °C). The data suggest that no counter Na(+) was released in the binding. Spectroscopy data suggest that the binding, with a stoichiometry of 2, was accompanied with substantial conformational changes on SA, and the changes were insensitive to the variation of salt concentrations. To account for the non-classical results, we propose a salt bridge exchange model. The intramolecular binding-site salt bridge(s) of the free SA and the charged phosphate group of aptamers re-organize to form the binding complex by forming a new intermolecular salt bridge(s). The salt bridge exchange binding process requires minimum amount of counter ions releasing but dehydration of the contacting surface of SA and the aptamer. The energy required for dehydration is reduced in the case of binding solution with higher salt concentration and account for the higher binding exothermic mainly.

Revisiting the streptavidin–biotin binding by using an aptamer and displacement isothermal calorimetry titration

“…The SA, aptamer (5′ATTGACCGCTGTGTGACGCAACACTCAAT3′ Genomics Inc., Taipei, Taiwan) and biotin were dissolved in a Tris (2‐amino‐2‐(hydroxymethyl)‐1,3‐propanediol)‐buffered saline (25 mM Tris‐HCl, pH 7.4, 120 mM NaCl, 5 mM KCl and 3 mM MgCl 2 ). The titration experiments were conducted as previously described by (Kuo et al ., ). Briefly, the receptor solution (SA or aptamer–SA complex) was loaded into the chamber (1.44 mL) of an ITC instrument (Microcal Omega, MCS and/or VP‐ITC, Microcal Inc.).…”

“…The titration syringe (293 μL volume) was filled with the appropriate ligand solution. The titrations were performed by injecting one 2‐μL and 29 10‐μL ligand solutions into the ITC chamber as described (Kuo et al ., ). The release of heat from each injection was plotted as ITC compensating power (dQ/dt) versus time.…”

“…The nature (e.g. hydrophilic vs. hydrophobic) and driving forces (enthalpy vs. entropy) of molecular binding can be inferred from these parameters (Ladbury and Chowdhry, ; Velazquez‐Campoy et al ., ; Roselin et al ., ; Kuo et al ., ). However, conventional ITC is only suitable for studying molecular interactions when K a is in the range of 10 5 –10 8 M −1 .…”

“…Determining the binding affinity constant (K a ) and stoichiometry ( n ) is a prerequisite to understanding and controlling molecular binding. Among the numerous methods for determining K a values, isothermal titration calorimetry (ITC) is particularly useful (Velazquez‐Campoy et al ., ; Lin et al ., ; Lin et al ., ; Bouchemal et al ., ; Roselin et al ., ; Ghai et al ., ; Kuo et al ., ), because ITC can yield the K a , n , free energy (ΔG), enthalpy (ΔH) and entropy (ΔS) values in a single experiment. The nature (e.g.…”

A replaceable liposomal aptamer for the ultrasensitive and rapid detection of biotin

“…The sequences of the ST-21 and ST-21M aptamers were 5′-ATTGACCGCTGTGTGACGCAACACTCAAT-3′ and 5′-ATTGACCTCTGTGTGACGCAACACTCAA T-3′, respectively. They were designed with 1 base difference (from 5′ the 8 th G is replaced by T) and their dissociation constant were 92.85 nM 21 and 3870 nM, respectively. Each aptamer was modified to have 3′- cholesterol ( Fig.…”