(S,S)‐2,3‐Dihydroxy‐2,3‐dihydrobenzoic Acid: Microbial Access with Engineered Cells of Escherichia coli and Application as Starting Material in Natural‐Product Synthesis.

Abstract

Carboxylic acidsCarboxylic acids Q 0420 (S,S)-2,3-Dihydroxy-2,3-dihydrobenzoic Acid: Microbial Access with Engineered Cells of Escherichia coli and Application as Starting Material in Natural-Product Synthesis. -An efficient microbial synthesis of the title acid (II) is reported using methods of deregulating the metabolic flux in E. coli strains. (II) can easily be transformed into the enantiomer(V) of the plant-growth inhibitor streptol. -(FRANKE, D.; LORBACH, V.; ESSER, S.; DOSE, C.; SPRENGER, G. A.; HALFAR, M.; THOEMMES, J.; MUELLER, R.; TAKORS, R.; MUELLER*, M.; Chem. Eur. J. 9 (2003) 17, 4188-4196; Inst. Biotechnol., Forschungszent. Juelich GmbH, D-52425 Juelich, Germany; Eng.) -Jannicke 51-093

Characterization and Biological Function of the ISOCHORISMATE SYNTHASE2 Gene of Arabidopsis

“…Empty vector pJF119EH1 and EntC-overexpressing construct pDF2 (Franke et al, 2003) were a kind gift from G. Sprenger (Stuttgart, Germany). ICS1 coding sequence without the first 45 amino acids was flanked with NcoI and BamHI restriction sites by amplification with primers ICS1-1 (AACTTTAA-GAAGGAGATATACCATGGCATATGCTATGTCTATGAATGGTTGTGAT) and ICS1-2 (GGATCCTCAATTAATCGCCTGTAGAGA) and was subcloned into the pGEM-T-Easy vector (Promega).…”

The ycaC‐related protein from the amphioxus Branchiostoma belcheri (BbycaCR) interacts with creatine kinase

“…Isochorismatase activity was assayed as described by Rusnak et al. [1], by using chorismate acid as the alternative substrate [17], and nicotinamidase activity was measured as described by Anderson et al. [18], by using nicotinamide as the substrate.…”

“…As BbycaCR protein belongs to the isochorismatase superfamily and has structural similarities to some other enzymes of the superfamily, including isochorismatase, nicotinamidase and N-carbamoylsarcosine amidohydrolase [4,6], all three enzyme activities of the recombinant protein expressed in E. coli were tested. Isochorismatase activity was assayed as described by Rusnak et al [1], by using chorismate acid as the alternative substrate [17], and nicotinamidase activity was measured as described by Anderson et al [18], by using nicotinamide as the substrate. For N-carbamoylsarcosine amidohydrolase activity assay, the substrate N-carbamoylsarcosine was chemically synthesized with sarcosine and potassium cyanate by the method of Nyc & Mitchell [19], and the enzyme activity was detected as described by Zajc et al [20].…”

Serial 13C-Based Flux Analysis of an L-Phenylalanine-Producing E. coli Strain Using the Sensor Reactor

“…Several production approaches have been published using, for instance, recombinant E. coli strains. Examples are the production of pathway intermediates such as 3-dehydroshikimic acid (Li et al, 1999), shikimic acid (Chandram et al, 2003), chorismate derivatives such as trans-2,3-cyclohexanediole (Franke et al, 2003a), or trans-3,4-cyclohexanediole (Franke et al, 2003b) and the final pathway products L-tryptophane, L-tyrosine, and L-phenylalanine (Bongaerts et al, 2001; Drauz et al, 2002;Gerigk et al, 2002). Among these products, L-phenylalanine currently represents the largest economical market with 11 000 to 12 000 tons per year and a product price of 20-40 US$/ kg depending on the product purity (Bongaerts et al, 2001).…”