RT-PCR Mediated Cloning and Sequence Analysis of Lily Symptomless Virus Coat Protein Gene.

Takamatsu, Susumu; Lin, Bo-Nian; Furuta, Hideo; Makara, Koichi

doi:10.3186/jjphytopath.60.487

Cited by 9 publications

(4 citation statements)

References 9 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…When RT–PCR was carried out using specific primers for LSV (Takamatsu et al ., 1994), all five lilies showed the amplification of a fragment of c . 900 bp, as expected (Takamatsu et al ., 1994). Results of RT–PCR show the widespread presence of LSV among the various lilies and even outside the Liliaceae.…”

Section: Resultsmentioning

confidence: 99%

See 1 more Smart Citation

Variability in the coat protein of Lily symptomless virus isolates infecting various lily species

et al. 2005

View full text Add to dashboard Cite

The coat protein sequences were characterized of Lily symptomless virus (LSV) isolates infecting Lilium longiflorum , Lilium tigrinum , Hymenocalis littoralis (spider lily) and Asiatic and Oriental hybrid lilies in India. The Indian isolates showed 78 -96% homology with each other. With LSV isolates from elsewhere in the world, the Indian isolates showed 83 -98% homology. The LSV-L ( L. longiflorum ) and LSV-A (Asiatic hybrid) isolates had unique stretches in the middle portion of the protein not found in other LSV isolates, even the Indian ones. The LSV gene sequence from the spider lily isolate (LSV-S) was reported for the first time outside the Liliaceae. LSV-S was 84 -96% similar to the other Indian isolates at the protein level. The isolate infecting tiger lily (LSV-T) was found to be different from the characterized isolates from elsewhere in the world (78 -84% homology at the protein level). At the same time, LSV-T showed much variability in the C-terminal of the protein. A stretch of 41 amino acids in the C-terminal was unique to this isolate. LSV-T is proposed as a distinct isolate of LSV infecting L. tigrinum indigenous to India.

show abstract

Section: Resultsmentioning

confidence: 99%

“…RT–PCR was used to amplify the coat protein gene of LSV with the help of a specific primer pair (Takamatsu et al ., 1994): U 5′‐AAGGATCCATGCAATCAAGACCAAGA‐3′ (upstream primer) and D 5′‐AAGAGCTCTCATCCATTATTTGCGTA‐3′ (downstream primer).…”

Section: Methodsmentioning

confidence: 99%

Variability in the coat protein of Lily symptomless virus isolates infecting various lily species

et al. 2005

View full text Add to dashboard Cite

show abstract

“…To confirm the identity of the virus, plants were tested by DAS-ELISA using LSV-specific antibodies (Agdia, USA) and six out of 27 plants with symptoms tested positive. LSV infection was confirmed by RT-PCR using a primer pair specific to the 3 ′ terminal of the virus (Takamatsu et al ., 1994). An amplicon of the expected size (approximately 900 bp) was obtained.…”

mentioning

confidence: 99%

Natural occurrence of Lily symptomless virus on spider lily

et al. 2005

View full text Add to dashboard Cite

“…The genome sequence and ORF organization of CGRMV were compared to the following viruses : apple stem pitting virus (ASPV, D21829 ; Jelkmann, 1994), potato X potexvirus (PVX, D00344 ; Huisman et al, 1988), lily X potexvirus (LVX, X15342 ; Memelink et al, 1990), lily symptomless carlavirus (LSV, D43801 ; Takamatsu et al, 1994), potato virus S carlavirus (PVS, D00461 ; MacKenzie et al, 1989) and potato M carlavirus (PVM, X53062 ; Zavriev et al, 1991).…”

Section: Coat Protein Expression and Immunoblot Analysis Of Viral Promentioning

confidence: 99%

cDNA cloning and molecular characterization of cherry green ring mottle virus.

Zhang

Kirkpatrick

Smart

et al. 1998

Journal of General Virology

View full text Add to dashboard Cite

The complete nucleotide sequence of the cherry green ring mottle virus (CGRMV) genome was determined to be 8372 nt excluding a 3h poly(A) tail. Based on computer analysis and sequence comparison, five open reading frames (ORFs) were identified on the virion strand encoding : a putative RNA-dependent RNA polymerase, a triple gene block and a coat protein. Two other ORFs with M r values over 10 000 and internal to the helicase and coat protein genes, but of unknown function, were also identified. Sequence and genome structure

show abstract

RT-PCR Mediated Cloning and Sequence Analysis of Lily Symptomless Virus Coat Protein Gene.

Cited by 9 publications

References 9 publications

Variability in the coat protein of Lily symptomless virus isolates infecting various lily species

Variability in the coat protein of Lily symptomless virus isolates infecting various lily species

Natural occurrence of Lily symptomless virus on spider lily

cDNA cloning and molecular characterization of cherry green ring mottle virus.

Contact Info

Product

Resources

About