Roles of MMP/TIMP in regulating matrix swelling and cell migration during chick corneal development

Abstract

Tissue remodeling is central to embryonic development. Here, we used immunohistochemistry, Western blotting, and RT-PCR analysis to investigate the roles of matrix metalloproteinases (MMPs) and the related "a disintegrin and metalloproteinase" (ADAM) family proteinases in chick corneal development. While MMP-13 was expressed in developing chick corneas from embryonic day (ED) 5 to ED 10, its inhibitor, tissue inhibitors of metalloproteinase-1 (TIMP-1), was expressed from ED 18 to 2 days post-hatching (P2). Early MMP-13 activity may be associated with degradation of type IX collagen from the primary stroma, which loosens the collagen fibrils and facilitates neural crest (NC) cell migration. The membrane-bound and secreted forms of ADAM10 were both detected throughout corneal development, and active ADAM10 formed a cleavage complex with CD44v6, a CD44 splice variant that is a major cell surface adhesion molecule for hyaluronic acid (HA) and has been implicated in cell migration. Both CD44v6 and its ectodomain cleavage products were detected from ED 5 to ED 14, and a broad-spectrum MMP inhibitor blocked ectodomain cleavage in cultured stromal cells. These findings suggest that ADAM10 mediates CD44v6 cleavage in the developing cornea, facilitating NC cell-derived mesenchymal cell migration. Finally, we identified high levels of active membrane-type 3-MMP (MT3-MMP) in developing corneas at ED 7, ED 14, and ED 18. MT3-MMP takes part in MMP-2 activation and possibly also CD44v6 shedding, suggesting that this pathway may be involved in cell migration. These findings collectively show for the first time that multiple MMPs, ADAMs, and TIMPs appear to functionally interact during corneal development.

Extracellular metalloproteinases in neural crest development and craniofacial morphogenesis

“…CD44v6, which has been identified as a substrate for both MT3-MMP and ADAM10, was also found in NC cells in the same area (Huh et al, 2007). The study suggested that MT3-MMP may play a role in MMP-2 activation or CD44v6 cleavage to promote corneal development, although ADAM10 may also provide the latter function.…”

“…ADAM10 is expressed in chick NC cells (Hall & Erickson, 2003) and Shoval et al showed that BMP4 enhances NC cell delamination, most likely by promoting ADAM10-mediated cleavage of N-cadherin in the quail embryo (Shoval et al, 2007). Another study showed that ADAM10-mediated cleavage of CD44v6 facilitates NC cell-derived mesenchymal cell migration into the chick cornea (Huh et al, 2007).…”

Expression of matrix metalloproteinase-13 (MMP-13) in the testes of growing and adult chicken

“…In brief, RNAzol B was used to isolate total RNA from 4-week-old chicken testes and developing chicken corneas on embryonic day (ED) 5 as a control, after which 1 g of total RNA was used to generate oligo(dT)18-primed cDNA using an RT-PCR kit (Clontech, Palo Alto, CA, USA), according to the manufacturer's instructions. Amplification of MMP-13 was conducted using previously described primers (#782-801, TTTGGGCTATGAATGGCTAT and #1098-1117, TAGTATGCAGGATGCGGACA) (Huh et al, 2007), and the reaction conditions were as follows: one cycle at 94 • C for 2 min, 58 • C for 30 s, and 72 • C for 1 min, 35 cycles at 94 • C for 30 s, 58 • C for 30 s, and 72 • C for 30 s, and a final elongation at 72 • C for 10 min. This method resulted in amplification of a single major cDNA fragment (336 bp), as visualized by agarose gel electrophoresis.…”

“…RT-PCR was performed and analyzed as previously described (Huh et al, 2007). In brief, RNAzol B was used to isolate total RNA from 4-week-old chicken testes and developing chicken corneas on embryonic day (ED) 5 as a control, after which 1 g of total RNA was used to generate oligo(dT)18-primed cDNA using an RT-PCR kit (Clontech, Palo Alto, CA, USA), according to the manufacturer's instructions.…”

Invasion by Matrix Metalloproteinase-Expressing Cells Is Important for Primitive Streak Formation in Early Chick Blastoderm

“…Chick TIMP-1 [Ozyigit et al, 2005;Huh et al, 2007], chick TIMP-2 [Aimes et al, 1998;Cantemir et al, 2004] and chick TIMP-3 [Yang and Hawkes, 1992] have been cloned; of these, TIMP-2 is known to be involved in pro-MMP-2 activation [Cantemir et al, 2004]. Similarly, MT3-MMP is also known to activate pro-MMP-2 at the cell surface to mature MMP-2 in human tumors and rheumatoid synovia [Kitagawa et al, 1998;Nakada et al, 1999;Yamanaka et al, 2000].…”