Roles of Amino Acid Residues near the Chromophore of Photoactive Yellow Protein

Imamoto, Yasushi; Koshimizu, Hisatsugu; Mihara, Kenichi; Hisatomi, Osamu; Mizukami, Taku; Tsujimoto, Kazuo; Kataoka, Mikio; Tokunaga, Fumio

doi:10.1021/bi002291u

Cited by 54 publications

(90 citation statements)

References 26 publications

(48 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…2a shows the absorption spectra of PYP suspended in the buffer at pH 4.0 -8.5 in the dark. The absorption spectrum of PYP is independent of pH in this pH region, although it is bleached at pH Ͻ 4.1 (pK a ϭ 3) (35,36). Then samples at various pH values were irradiated by continuous yellow light (Ͼ410 nm), and the absorption spectra of the photosteady state were recorded.…”

Section: Journal Of Biological Chemistry 4319mentioning

confidence: 99%

pH-dependent Equilibrium between Long Lived Near-UV Intermediates of Photoactive Yellow Protein

Shimizu¹,

Imamoto

Harigai

et al. 2006

Journal of Biological Chemistry

Self Cite

View full text Add to dashboard Cite

Photoactive yellow protein (PYP) 3 (1) is a water-soluble photoreceptor protein suggested to be involved in the negative phototaxis of Halorhodospira halophila (2). PYP is an attractive model protein for a common signaling mechanism because it is a structural prototype of the PAS domain superfamily, most of which are involved in the biological sensing (3). PYP is composed of 125 amino acid residues and the p-coumaric acid chromophore linking to the cysteine residue by a thioester bond (4 -6). In the dark state, the phenolic oxygen of the chromophore is deprotonated (5) and hydrogen bonded with protonated Tyr-42 and Glu-46 (see Fig. 1), resulting in the yellow color. Photon absorption by the chromophore initiates the photocycle of PYP (7-11). The primary photochemical event of PYP is the trans-cis isomerization of the chromophore (12, 13), like bacterial retinal proteins. Several intermediates are then formed, followed by a return to the dark state in 100 ms under physiological conditions. During the photocycle, photon energy stored in the twisted chromophore is released to the protein moiety to form the putative signaling state (called PYP M , I 2 , or pB). Because of a largely blue-shifted absorption spectrum with respect to the dark state, as well as the long lifetime (ϳ100 ms), PYP M is easily detectable by UV-visible spectroscopy. This spectral blue shift is considered to be caused by protonation of the phenolic oxygen of the chromophore (5,14).Infrared spectroscopy demonstrated that PYP M is formed from its precursor (PYP L , I 1 , or pR) in two steps (15, 16). First, a proton at Glu-46 is transferred to the chromophore, but the global conformational change of the protein moiety does not take place at this stage, as shown by a small absorbance change of the amide mode. This intermediate (pBЈ) has a protonated chromophore, but the chromophore binding site is considered to be preserved. Second, a global conformational change takes place to form PYP M . As the lifetime of pBЈ (ϳ1 ms) is not markedly different from pR (ϳ100 s) and the absorption spectra of PYP M and pBЈ are similar, isolation of pBЈ has been difficult in steady-state measurement. Recently, the presence of pBЈ between PYP L and PYP M has been established by time-resolved UV-visible spectroscopy and Raman spectroscopy (17)(18)(19).Although the signaling pathway of the PYP system has not yet been identified, detailed characterization of long lived intermediates (signaling state) is essential for understanding the signal transduction mechanism of PYP. We have demonstrated extensive conformational change upon formation of PYP M . The dimension of PYP M is significantly larger than the dark state as shown by ϳ1 Å increase of R g (20,21) and PYP M is in a partially unfolded state (22). The N-terminal cap and the central part undergo a substantial structural change (21, 23); however, the cause of this large conformational change has not yet been determined.Accumulated evidence suggests that properties of PYP M are highly pH-sensitive. The extent of con...

show abstract

Section: Journal Of Biological Chemistry 4319mentioning

confidence: 99%

pH-dependent Equilibrium between Long Lived Near-UV Intermediates of Photoactive Yellow Protein

Shimizu¹,

Imamoto

Harigai

et al. 2006

Journal of Biological Chemistry

Self Cite

View full text Add to dashboard Cite

show abstract

“…PYP F62W/W119F has a shoulder at 390 nm in its main absorption band. Such an intermediate spectral species is also observed in several Y42 mutants, [53][54][55] the best studied of which is Y42F. In these mutants the chromophore in the dark ( pG) state is in equilibrium between the yellow form and the blue-shifted intermediate spectral form.…”

Section: Absorption and Kinetic Characteristics: Significant Changesmentioning

confidence: 85%

“…For Y42 mutants (Y42F, Y42A, and Y42W) this has been observed before. [53][54][55] The shoulder in the absorption spectrum of F62W/W119F has several F6W GACAAAATGGAACACGTAGCCTGGGGTAGCGAGGACATCG F28W CGACGGCCTGGCCTGGGGCGCCATCCAGC F62W GGTCATCGGCAAGAACTGGTTCAAGGACGTGGCC F92W GCAACCTGAACACGATGTGGGAGTACACCTTCGATTACC Y94W GCAACCTGAACACGATGTTCGAGTGGACCTTCGATTACCAAATGACGCCCAC F96W CGATGTTCGAGTACACCTGGGATTACCAAATGACGCCC Y98W CGATGTTCGAGTACACCTTCGATTGGCAAATGACGCCCACGAAGG H108W CCCACGAAGGTGAAGGTGTGGATGAAGAAGGCCCTCTCCG W119F CCGGCGACAGCTACTTCGTCTTCGTCAAGCGC…”

Section: Characterisation Of Pyp Mutantsmentioning

confidence: 99%

Tryptophan fluorescence as a reporter for structural changes in photoactive yellow protein elicited by photo-activation

Hospes

Hendriks

Hellingwerf

2013

Photochem Photobiol Sci

View full text Add to dashboard Cite

Light-activation of photoactive yellow protein (PYP) is followed by a series of dynamical transitions in the structure of the protein. Tryptophan fluorescence is well-suited as a tool to study selected aspects of these. Using site-directed mutagenesis eight 'single-tryptophan' mutants of PYP were made by replacement of either a tyrosine, phenylalanine or histidine residue by tryptophan, while simultaneously eliminating the endogenous W119. Surprisingly, only three of these eight mutants turn out to emit measurable tryptophan fluorescence: F6W/W119F, F96W/W119F and H108W/W119F. Significantly, all three show altered tryptophan fluorescence upon formation of the pB state. As F96 is located very close to the chromophore, the F96W/W119F mutant protein is particularly suitable for further studies on the dynamical changes of the polarity in the chromophore-binding pocket of PYP. Furthermore, WT PYP can be photo-activated by a UV photon via the highly conserved W119 and subsequent Förster resonance energy transfer. Placing a unique tryptophan residue elsewhere in the protein shows that position 119 is favoured for UV-activation of PYP.

show abstract

“…Owing to this "pK a inversion" the ionized [28] pCA (normally a base) is hydrogen bonded to the protonated [10,33] side chain of Glu46 (normally an acid). Mutations in both Glu46 and Tyr42 significantly shift the pK a of the pCA in the direction of its value in solution [53][54][55]. This indicates the importance of the hydrogen bonds of Glu46 and Tyr42 to the pCA in downshifting its pK a .…”

Section: Hydrogen Bonding In the Initial State Of Pypmentioning

confidence: 91%

Changes in Active Site Hydrogen Bonding upon Formation of the Electronically Excited State of Photoactive Yellow Protein

Hoff

Kang

Kumauchi

et al. 2010

Hydrogen Bonding and Transfer in the Excited State

View full text Add to dashboard Cite

Light plays three main roles in biology. First, light from the sun provides the main source of energy driving the biosphere through chlorophyll-based electron transfer in photosynthetic reaction centers and retinal-based proton pumping in rhodopsins [1]. Second, light is a source of information about the environment for many organisms using photosensory proteins, including animals, plants, fungi and bacteria [2,3]. Third, light can cause damage to biological systems. Light from the near-UV region can damage DNA [4], and excess visible light can damage the photosynthetic machinery in photoinhibition [5]. Thus, light is of great importance for a wide range of biological processes.Proteins that perform photosynthesis or light sensing consist of an apoprotein and a bound chromophore. Only a small number of chromophores account for most known processes in photobiology: chlorophyll and linear tetrapyrroles, caretoids and retinal, flavins and p-coumaric acid [2]. In many cases the chromophore has strong and functionally important interactions with the protein binding pocket, particularly charge-charge interactions and hydrogen bonding interactions. While many different proteins interact with light in a wide range of organisms, almost all of these systems are based on key types of photochemical processes, including electron transfer, C¼C double bond isomerization and the formation of chemical bonds [2,6]. These photochemical events often trigger a cascade of thermal reactions in the protein that extends to the millisecond and minute range, and that result in a biologically relevant output. If the cascade of thermal reactions results in the re-formation of the initial state, the process is referred to as a photocycle. It is the initial ultrafast

show abstract

Roles of Amino Acid Residues near the Chromophore of Photoactive Yellow Protein

Cited by 54 publications

References 26 publications

pH-dependent Equilibrium between Long Lived Near-UV Intermediates of Photoactive Yellow Protein

pH-dependent Equilibrium between Long Lived Near-UV Intermediates of Photoactive Yellow Protein

Tryptophan fluorescence as a reporter for structural changes in photoactive yellow protein elicited by photo-activation

Changes in Active Site Hydrogen Bonding upon Formation of the Electronically Excited State of Photoactive Yellow Protein

Contact Info

Product

Resources

About