Role of the Two Component Signal Transduction System CpxAR in Conferring Cefepime and Chloramphenicol Resistance in Klebsiella pneumoniae NTUH-K2044

Srinivasan, Vijaya Bharathi; Vaidyanathan, Vasanth; Mondal, Amitabha; Rajamohan, Govindan

doi:10.1371/journal.pone.0033777

Cited by 79 publications

(77 citation statements)

References 29 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The CpxAR system was shown to be involved in Salmonella resistance to protamine and several ␣-helical AMPs (55). More recently, the CpxAR system was shown to be induced upon exposure to an antimicrobial cationic polyethylenimine in E. coli (56) and to confer resistance to several ␤-lactams and chloramphenicol in Klebsiella pneumoniae (57). Here we showed that inactivation of cpxR increased the sensitivity of E. coli to ApoEdpL-W.…”

Section: Discussionmentioning

confidence: 56%

Induction of the Cpx Envelope Stress Pathway Contributes to Escherichia coli Tolerance to Antimicrobial Peptides

Audrain

Ferrières

Zaïri

et al. 2013

Appl Environ Microbiol

View full text Add to dashboard Cite

e Antimicrobial peptides produced by multicellular organisms as part of their innate system of defense against microorganisms are currently considered potential alternatives to conventional antibiotics in case of infection by multiresistant bacteria. However, while the mode of action of antimicrobial peptides is relatively well described, resistance mechanisms potentially induced or selected by these peptides are still poorly understood. In this work, we studied the mechanisms of action and resistance potentially induced by ApoEdpL-W, a new antimicrobial peptide derived from human apolipoprotein E. Investigation of the genetic response of Escherichia coli upon exposure to sublethal concentrations of ApoEdpL-W revealed that this antimicrobial peptide triggers activation of RcsCDB, CpxAR, and E envelope stress pathways. This genetic response is not restricted to ApoEdpL-W, since several other antimicrobial peptides, including polymyxin B, melittin, LL-37, and modified S 4 dermaseptin, also activate several E. coli envelope stress pathways. Finally, we demonstrate that induction of the CpxAR two-component system directly contributes to E. coli tolerance toward ApoEdpL-W, polymyxin B, and melittin. These results therefore show that E. coli senses and responds to different antimicrobial peptides by activation of the CpxAR pathway. While this study further extends the understanding of the array of peptide-induced stress signaling systems, it also provides insight into the contribution of Cpx envelope stress pathway to E. coli tolerance to antimicrobial peptides.

show abstract

Section: Discussionmentioning

confidence: 56%

Induction of the Cpx Envelope Stress Pathway Contributes to Escherichia coli Tolerance to Antimicrobial Peptides

Audrain

Ferrières

Zaïri

et al. 2013

Appl Environ Microbiol

View full text Add to dashboard Cite

show abstract

“…The expression of eefABC appears to be induced by an acidic or hyperosmolar environment but not by bile salts (793). The CpxAR system and the LysR-type OxyR regulator are also involved in the positive control of the expression of the acrB, acrD, and/or eefB efflux gene (794,795).…”

Section: K Pneumoniae Efflux Pumpsmentioning

confidence: 99%

The Challenge of Efflux-Mediated Antibiotic Resistance in Gram-Negative Bacteria

2015

View full text Add to dashboard Cite

SUMMARY The global emergence of multidrug-resistant Gram-negative bacteria is a growing threat to antibiotic therapy. The chromosomally encoded drug efflux mechanisms that are ubiquitous in these bacteria greatly contribute to antibiotic resistance and present a major challenge for antibiotic development. Multidrug pumps, particularly those represented by the clinically relevant AcrAB-TolC and Mex pumps of the resistance-nodulation-division (RND) superfamily, not only mediate intrinsic and acquired multidrug resistance (MDR) but also are involved in other functions, including the bacterial stress response and pathogenicity. Additionally, efflux pumps interact synergistically with other resistance mechanisms (e.g., with the outer membrane permeability barrier) to increase resistance levels. Since the discovery of RND pumps in the early 1990s, remarkable scientific and technological advances have allowed for an in-depth understanding of the structural and biochemical basis, substrate profiles, molecular regulation, and inhibition of MDR pumps. However, the development of clinically useful efflux pump inhibitors and/or new antibiotics that can bypass pump effects continues to be a challenge. Plasmid-borne efflux pump genes (including those for RND pumps) have increasingly been identified. This article highlights the recent progress obtained for organisms of clinical significance, together with methodological considerations for the characterization of MDR pumps.

show abstract

“…Analysis of completed Klebsiella genomes reveals the presence of several additional novel putative efflux systems from other families (20); however, experimental proof of their role in antimicrobial resistance has never been documented. Previously, we demonstrated that cpxAR two-component signaling system modulates the expression of efflux pumps to mediate antimicrobial resistance in K. pneumoniae (25,26). -R TGATATGGTTTCGGCTAATTCC 47 Kprt3712-F AGTCATCTTCAGCATATTTCTCT 47 Kprt3712-R CAACAATAGCACCTTTCCCT 47 MagAF1 GGTGCTCTTTACATCATTGC 48 MagAR1 GCAATGGCCATTTGCGTTAG 48 K2wzy-F1 GACCCGATATTCATACTTGACAGAG 48 K2wzy-R1 CCTGAAGTAAAATCGTAAATAGATGGC 48 K5wzxF360 TGGTAGTGATGCTCGCGA 48 K5wzxR639 CCTGAACCCACCCCAATC 48 wzxK54F CATTAGCTCAGTGGTTGGCT 48 wzxK54R GCTTGACAAACACCATAGCAG 48 wzyK57F CTCAGGGCTAGAAGTGTCAT 48 wzyK57R CACTAACCCAGAAAGTCGAG 48 wzyK20F CGGTGCTACAGTGCATCATT 48 wzyK20R GTTATACGATGCTCAGTCGC 48 rmpAF ACTGGGCTACCTCTGCTTCA 48 rmpAR CTTGCATGAGCCATCTTTCA 48 Bacterial growth curves.…”

mentioning

confidence: 99%

“…The experiment was performed with freshly autoclaved medium in triplicates at least three independent times. A growth inactivation assay was performed to assess the impact on drug efflux capacity, as described previously with slight modifications (25,26). WT and ⌬kpnEF cultures at mid-log phase (OD 600 ϭ 0.2) were inoculated into LB broth containing antibiotics such as chloramphenicol, erythromycin, or tetracycline (0.05 g/ml) in independent experiments either alone or with efflux pump inhibitor carbonyl cyanide 3-chlorophenylhydrazone (CCCP; Sigma, St. Louis, MO) at 10 g/ml.…”

mentioning

confidence: 99%

KpnEF, a New Member of the Klebsiella pneumoniae Cell Envelope Stress Response Regulon, Is an SMR-Type Efflux Pump Involved in Broad-Spectrum Antimicrobial Resistance

Srinivasan

Rajamohan

2013

Antimicrob Agents Chemother

Self Cite

157

109

View full text Add to dashboard Cite

Klebsiella pneumoniae has been frequently associated with nosocomial infections. Efflux systems are ubiquitous transporters that also function in drug resistance. Genome analysis of K. pneumoniae strain NTUH-K2044 revealed the presence of ϳ15 putative drug efflux systems. We discuss here for the first time the characterization of a putative SMR-type efflux pump, an ebrAB homolog (denoted here as kpnEF) with respect to Klebsiella physiology and the multidrug-resistant phenotype. Analysis of hypermucoviscosity revealed direct involvement of kpnEF in capsule synthesis. The ⌬kpnEF mutant displayed higher sensitivity to hyperosmotic (ϳ2.8-fold) and high bile (ϳ4.0-fold) concentrations. Mutation in kpnEF resulted in increased susceptibility to cefepime, ceftriaxone, colistin, erythromycin, rifampin, tetracycline, and streptomycin; mutated strains changed from being resistant to being susceptible, and the resistance was restored upon complementation. The ⌬kpnEF mutant displayed enhanced sensitivity toward structurally related compounds such as sodium dodecyl sulfate, deoxycholate, and dyes, including clinically relevant disinfectants such as benzalkonium chloride, chlorhexidine, and triclosan. The prevalence of kpnEF in clinical strains broadens the diversity of antibiotic resistance in K. pneumoniae. Experimental evidence of CpxR binding to the efflux pump promoter and quantification of its expression in a cpxAR mutant background demonstrated kpnEF to be a member of the Cpx regulon. This study helps to elucidate the unprecedented biological functions of the SMR-type efflux pump in Klebsiella spp.

show abstract

Role of the Two Component Signal Transduction System CpxAR in Conferring Cefepime and Chloramphenicol Resistance in Klebsiella pneumoniae NTUH-K2044

Cited by 79 publications

References 29 publications

Induction of the Cpx Envelope Stress Pathway Contributes to Escherichia coli Tolerance to Antimicrobial Peptides

Induction of the Cpx Envelope Stress Pathway Contributes to Escherichia coli Tolerance to Antimicrobial Peptides

The Challenge of Efflux-Mediated Antibiotic Resistance in Gram-Negative Bacteria

KpnEF, a New Member of the Klebsiella pneumoniae Cell Envelope Stress Response Regulon, Is an SMR-Type Efflux Pump Involved in Broad-Spectrum Antimicrobial Resistance

Contact Info

Product

Resources

About