Role of the Carboxy Terminus of SecA in Iron Acquisition, Protein Translocation, and Virulence of the Bacterial Pathogen Acinetobacter baumannii

Fiester, Steven E.; Nwugo, Chika C.; Penwell, William F.; Neary, John M.; Beckett, Amber C.; Arivett, Brock A.; Schmidt, Robert E.; Geiger, Sarah C.; Connerly, Pamela L.; Menke, Sharon M.; Tomaras, Andrew P.; Actis, Luis A.

doi:10.1128/iai.02925-14

Cited by 14 publications

(10 citation statements)

References 71 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The 24-h time point was chosen for RNA isolation because there was not apparent hemolytic activity until this time. RNA isolation, cDNA synthesis and qRT-PCR analyses were performed as previously described [43]. Briefly, bacterial cells were lysed in lysis buffer [0.3 M sodium acetate (pH 4.0), 30 mM EDTA and 3% SDS] previous to RNA purification following the manufacturer’s protocol included with the Maxwell 16 LEV simplyRNA Tissue Kit (Promega).…”

Section: Methodsmentioning

confidence: 99%

Iron-Regulated Phospholipase C Activity Contributes to the Cytolytic Activity and Virulence of Acinetobacter baumannii

et al. 2016

Self Cite

View full text Add to dashboard Cite

Acinetobacter baumannii is an opportunistic Gram-negative pathogen that causes a wide range of infections including pneumonia, septicemia, necrotizing fasciitis and severe wound and urinary tract infections. Analysis of A. baumannii representative strains grown in Chelex 100-treated medium for hemolytic activity demonstrated that this pathogen is increasingly hemolytic to sheep, human and horse erythrocytes, which interestingly contain increasing amounts of phosphatidylcholine in their membranes. Bioinformatic, genetic and functional analyses of 19 A. baumannii isolates showed that the genomes of each strain contained two phosphatidylcholine-specific phospholipase C (PC-PLC) genes, which were named plc1 and plc2. Accordingly, all of these strains were significantly hemolytic to horse erythrocytes and their culture supernatants tested positive for PC-PLC activity. Further analyses showed that the transcriptional expression of plc1 and plc2 and the production of phospholipase and thus hemolytic activity increased when bacteria were cultured under iron-chelation as compared to iron-rich conditions. Testing of the A. baumannii ATCC 19606T plc1::aph-FRT and plc2::aph isogenic insertion derivatives showed that these mutants had a significantly reduced PC-PLC activity as compared to the parental strain, while testing of plc1::ermAM/plc2::aph demonstrated that this double PC-PLC isogenic mutant expressed significantly reduced cytolytic and hemolytic activity. Interestingly, only plc1 was shown to contribute significantly to A. baumannii virulence using the Galleria mellonella infection model. Taken together, our data demonstrate that both PLC1 and PLC2, which have diverged from a common ancestor, play a concerted role in hemolytic and cytolytic activities; although PLC1 seems to play a more critical role in the virulence of A. baumannii when tested in an invertebrate model. These activities would provide access to intracellular iron stores this pathogen could use during growth in the infected host.

show abstract

Section: Methodsmentioning

confidence: 99%

Iron-Regulated Phospholipase C Activity Contributes to the Cytolytic Activity and Virulence of Acinetobacter baumannii

et al. 2016

Self Cite

View full text Add to dashboard Cite

show abstract

“…The assay was performed as previously reported (22). The isochorismatase parental allele was PCR amplified by using total strain 98–37–09 DNA as a template, Pfu DNA polymerase, and primers (forward: 5′‐CGGGATCCATGAAACAAGCACTATTAGTTATC‐3′; and reverse: 5′‐CGCCTAGGTTAAGATTTTGCTAGAAAGTCAG‐3′), both of which included BamHI restriction sites.…”

Section: Methodsmentioning

confidence: 99%

Critical role of bacterial isochorismatase in the autophagic process induced byAcinetobacter baumanniiin mammalian cells

et al. 2016

View full text Add to dashboard Cite

A recent study reported that Acinetobacter baumannii could induce autophagy, but the recognition and clearance mechanism of intracytosolic A. baumannii in the autophagic process and the molecular mechanism of autophagy induced by the pathogen remains unknown. In this study, we first demonstrated that invading A. baumannii induced a complete, ubiquitin-mediated autophagic response that is dependent upon septins SEPT2 and SEPT9 in mammalian cells. We also demonstrated that autophagy induced by A. baumannii was Beclin-1 dependent via the AMPK/ERK/mammalian target of rapamycin pathway. Of interest, we found that the isochorismatase mutant strain had significantly decreased siderophore-mediated ferric iron acquisition ability and had a reduced the ability to induce autophagy. We verified that isochorismatase was required for the recognition of intracytosolic A. baumannii mediated by septin cages, ubiquitinated proteins, and ubiquitin-binding adaptor proteins p62 and NDP52 in autophagic response. We also confirmed that isochorismatase was required for the clearance of invading A. baumannii by autophagy in vitro and in the mouse model of infection. Together, these findings provide insight into the distinctive recognition and clearance of intracytosolic A. baumannii by autophagy in host cells, and that isochorismatase plays a critical role in the A. baumannii–induced autophagic process.—Wang, Y., Zhang, K., Shi, X., Wang, C., Wang, F., Fan, J., Shen, F., Xu, J., Bao, W., Liu, M., Yu, L. Critical role of bacterial isochorismatase in the autophagic process induced by Acinetobacter baumannii in mammalian cells.

show abstract

“…Multiple studies conducted by prominent laboratories have demonstrated that iron or zinc limitation can suppress Acinetobacter growth and that the organisms have multiple iron and zinc acquisition mechanisms, including catechol production, production of very high-affinity siderophores (e.g., acinetobactin) and companion siderophore uptake receptor and energetic mechanisms, and heme utilization (82,121,(308)(309)(310)(311)(312)(313)(314)(315)(316)(317)(318)(319)(320). Small-molecule iron chelators have in vitro activity at killing Acinetobacter during log growth (318).…”

Section: Trace Metal Sequestrationmentioning

confidence: 99%

Clinical and Pathophysiological Overview of Acinetobacter Infections: a Century of Challenges

et al. 2017

View full text Add to dashboard Cite

SUMMARY Acinetobacter is a complex genus, and historically, there has been confusion about the existence of multiple species. The species commonly cause nosocomial infections, predominantly aspiration pneumonia and catheter-associated bacteremia, but can also cause soft tissue and urinary tract infections. Community-acquired infections by Acinetobacter spp. are increasingly reported. Transmission of Acinetobacter and subsequent disease is facilitated by the organism's environmental tenacity, resistance to desiccation, and evasion of host immunity. The virulence properties demonstrated by Acinetobacter spp. primarily stem from evasion of rapid clearance by the innate immune system, effectively enabling high bacterial density that triggers lipopolysaccharide (LPS)–Toll-like receptor 4 (TLR4)-mediated sepsis. Capsular polysaccharide is a critical virulence factor that enables immune evasion, while LPS triggers septic shock. However, the primary driver of clinical outcome is antibiotic resistance. Administration of initially effective therapy is key to improving survival, reducing 30-day mortality threefold. Regrettably, due to the high frequency of this organism having an extreme drug resistance (XDR) phenotype, early initiation of effective therapy is a major clinical challenge. Given its high rate of antibiotic resistance and abysmal outcomes (up to 70% mortality rate from infections caused by XDR strains in some case series), new preventative and therapeutic options for Acinetobacter spp. are desperately needed.

show abstract

Role of the Carboxy Terminus of SecA in Iron Acquisition, Protein Translocation, and Virulence of the Bacterial Pathogen Acinetobacter baumannii

Cited by 14 publications

References 71 publications

Iron-Regulated Phospholipase C Activity Contributes to the Cytolytic Activity and Virulence of Acinetobacter baumannii

Iron-Regulated Phospholipase C Activity Contributes to the Cytolytic Activity and Virulence of Acinetobacter baumannii

Critical role of bacterial isochorismatase in the autophagic process induced byAcinetobacter baumanniiin mammalian cells

Clinical and Pathophysiological Overview of Acinetobacter Infections: a Century of Challenges

Contact Info

Product

Resources

About