Role of Secondary Coordination Sphere Residues in Halogenation Catalysis of Non-heme Iron Enzymes

Abstract

Chemo-and regio-selective catalysis of the C(sp 3 )-H halogenation reaction is a formidable goal in chemical synthesis. 2-Oxoglutarate (2OG)-dependent non-heme iron halogenases catalyze selective chlorination/bromination of C−H bonds and exhibit high sequence and structural similarities with non-heme iron hydroxylases. How the secondary coordination sphere (SCS) of these two enzyme systems differentiate and determine their reactivity is not well understood. In this work, we show that specific positioning of redox-active tyrosine residues in the SCS of non-heme iron halogenases has a huge impact on their structure, function, and reactivity. We discover that a tyrosine residue (F121Y) rationally incorporated to hydrogen bond to iron's chloride ligand in SyrB2 halogenase undergoes post-translational oxidation to dihydroxyphenylalanine (DOPA) physiologically. A combination of spectroscopic, mass-spectrometric, and biochemical studies demonstrate that DOPA modification in SyrB2 renders the enzyme non-functional. Bioinformatic analysis suggests that SyrB2-like halogenases, unlike hydroxylases, have a conserved placement of phenylalanine at position 121 to preclude such unproductive oxidation. Furthermore, molecular dynamics simulations in tandem with experimental demonstration of DOPA incorporation exclusively at position 121 enables us to uniquely identify that an axial-chloro haloferryl isomer is operant in SyrB2. We also identify conserved redox-inactive residues in the SCS of other 2OG-dependent non-heme iron halogenases to avoid DOPA-like unproductive oxidations. Overall, this study demonstrates the importance of the SCS in controlling the structure and enzymatic activity of non-heme iron halogenases and will have significant implications toward the design of small-molecule and protein-based halogenation catalysts.

Electrostatically Regulated Active Site Assembly Governs Reactivity in Nonheme Iron Halogenases

“…Column choice, gradient method, and instrument parameters were adapted from previous studies. 36 The mass transitions monitored for each reaction are listed in Table S1.…”

“…Initial attempts to reprogram NHFe-Hyds into halogenases by this single amino acid substitution of Glu/Asp to Ala/Gly were unsuccessful in achieving the desired chemoselectivity, indicating a more complex molecular mechanism at play. − This motivated several experimental and computational studies to explore the factors determining the chemoselectivity of NHFe-Hals and engineered NHFe-Hyds. These factors include the configuration of the haloferryl isomer − and the oxo-Fe–H angle that it forms with the target C–H group, the optimal positioning of the substrate radical in relation to the chloride ligand of the Cl–Fe III –OH intermediate, ,, as well as protein pocket electrostatics that can facilitate chloride transfer. , While most of these studies have focused on the oxygen activation, C–H abstraction, and chloride transfer stages of the catalytic cycle (Figure S1), how catalytic pocket electrostatics can control the active site assembly when working with charged and untethered substrates like free lysine and functionalizing anions like chloride, along with their implications for the overall catalytic performance and product yields, remains unexplored. Thus, a more rigorous understanding of the entire catalytic cycle and how NHFe-Hals facilitate binding, activation, and reactivity with specific substrates and functionalizing anions is needed.…”

Understanding ATP Binding to DosS Catalytic Domain with a Short ATP-Lid

“…DosS CA mutants were prepared from the WT plasmid via site-directed mutagenesis with end-to-end primers similar to methods described in previous work. 22 The forward and reverse primers (5′ to 3′) for the H507F mutation were: ACACTTACAG-…”

“…pET23a (+) vectors encoding DosS CA (amino acids 454–578 of full-length DosS) and DosS DHp-CA (amino acids 369–578 of full-length DosS) sequence with an N-terminal six-His tag and a TEV protease site were purchased from GenScript. DosS CA mutants were prepared from the WT plasmid via site-directed mutagenesis with end-to-end primers similar to methods described in previous work . The forward and reverse primers (5′ to 3′) for the H507F mutation were: ACACTTACAGTAAGAGTGAAGGTAGACGATGATTTG and GGATGCCTTCGCGAATCTAACAGCGTT, respectively.…”

Introducing the Role of Metals in Biology to High School Students

“…Metals catalyze numerous biological processes and serve as cofactors for several key enzymes. − In fact, it has been estimated that nearly half of all enzymes utilize metals to maintain their structural integrity and functional roles. − For instance, the heme-copper complex in cytochrome c oxidase binds oxygen and facilitates reduction of oxygen to water during respiration − (Figure A, top panel), and the heme-iron cofactor in myoglobin enables storage of oxygen (Figure A, bottom panel). − Similarly, plants use calcium and manganese cofactors to catalyze the oxidation of water during photosynthesis (Figure B, top panel) , while symbiotic nitrogen-fixing bacteria in legumes use iron and molybdenum cofactors to convert nitrogen to ammonia (Figure B, bottom panel) . While it is clear that metals are involved in some of the most crucial biological processes, the knowledge of their existence in biology and humans is low among general public .…”