Role of Pin1 Protein in the Pathogenesis of Nonalcoholic Steatohepatitis in a Rodent Model

Abstract

Background: NASH is a disease characterized by fat accumulation and chronic inflammation in the liver. Results: Pin1 expression was increased in NASH model mouse livers. Pin1 KO mice were resistant to NASH development. Conclusion: Pin1 plays critical roles in NASH development. Significance: A Pin1 inhibitor might be a novel agent for treating NASH.

Prolyl Isomerase Pin1 Negatively Regulates AMP-activated Protein Kinase (AMPK) by Associating with the CBS Domain in the γ Subunit

“…Pin1 reportedly enhances the insulin-induced phosphorylation of insulin receptor substrate1 and suppresses the translocation of CRTC2 into the nucleus, thereby reducing CRE transcriptional activity (29,30). Interestingly, Pin1 KO mice were shown to be resistant to high-fat diet-induced obesity and to the non-alcoholic steatohepatitis development induced by a methionine choline-deficient diet (29,34).…”

“…Briefly, cDNAs encoding the ␣, ␤, and ␥ subunits of AMPK and Pin1, with or without S tag or FLAG tag at their N termini, were inserted into pcDNA3. Mutated Trp 34 and Lys 63 Pin1, lacking the ability to bind the WW protein domain and isomerase activity, respectively, were also prepared. For adenovirus preparation, the GFP or the Pin1 gene was inserted into a pAxCAwtit2 vector, and adenovirus was produced in 293 cells, using an adenovirus dual expression kit (Takara).…”

“…To measure the mRNA levels of PGC-1␣, Nrf1, Tfam, and cytochrome c, reverse transcription and real-time PCR were conducted as reported previously (34). Primer sets were as follows: mPGC-1␣, gca ctt cgg tca tcc ctg tc (forward) and ggc gac aca tcg aac aat ga (reverse); mNrf1, caa cag gga aga aac gga aa (forward) and gca cca cat tct cca aag gt (reverse); mTfam, aag ctt cca gga ggc aaa gg (forward) and tgt ctc cgg atc gtt tca ca (reverse); mCyt c, caaatctccacggtctgttcg (forward) and ggtctgccctttctcccttc (reverse).…”

Structure and function of the human parvulins Pin1 and Par14/17

“…Highly increased Pin1 levels induce the onset of obesity, the nonalcoholic fatty liver disease, diabetes mellitus and atherosclerosis (Nakatsu et al, 2011(Nakatsu et al, , 2012Lu et al, 2013;Paneni et al, 2015). Additionally, Pin1 has a biphasic effect on the insulin receptor substrate pathway (Saltiel and Kahn, 2001).…”

The prolyl isomerase Pin1 increases β-cell proliferation and enhances insulin secretion

“…Indeed, Pin1 binds to and modulates numerous important proteins that are key to the regulation of glucose and lipid by guest on http://www.jbc.org/ Downloaded from metabolism, including IRS-1, Crtc2 and AMPK [12,16,17]. Thus, Pin1 contributes to the regulation of gluconeogenesis, adipogenesis, fibrosis, fatty acid oxidation and bone differentiation as well as of the onset of metabolic syndromes, such as obesity and nonalcoholic steatohepatitits [12,[16][17][18][19][20].…”