Role of Opiorphin Genes in Prostate Cancer Growth and Progression

Mukherjee, Arnab; Park, Augene; Wang, Li; Davies, Kelvin P.

doi:10.2217/fon-2020-1299

Cited by 6 publications

(15 citation statements)

References 52 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…LNCaP clone FGC (NCI-PBCF-CRL1740 (LNCaP Clone FGC)/ATCC® CRL-1740 ™ ; hereafter termed LNCaP) was obtained from the American Type Culture Collection (ATCC, Rockville, MD, USA). The generation and characterization of LNCaP cells overexpressing PROL1 (LNCaP-ProL1+) has been previously described [ 11 ]. PROL1 knockout cell-lines (LNCaP-ProL1–) were generated using a commercially available PROL1 CRISPR knockout kit (Origene Technologies, Rockville, MD, USA); gRNA sequence GGACTTGGTGGAACCCATCT), according to manufacturers’ protocol.…”

Section: Methodsmentioning

confidence: 99%

“…The mouse xenograft studies used the same methods and procedures as previously described [ 11 ]. Castrated and intact male nude mice were injected with 2.5 × 10 6 LNCaP-ProL1+, LNCaP-ProL1– and LNCaP cells and tumor size determined twice a week.…”

Section: Methodsmentioning

confidence: 99%

“…RNA was isolated from cell-lines using the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany) and used to determine expression levels of PROL1 by quantitative-RT-PCR as previously described [ 11 ]. RNA was also sent to a commercial vendor (Novogene Corp., Sacramento, CA, USA) for performance of RNA-seq analysis of global gene expression as previously described.…”

Section: Methodsmentioning

confidence: 99%

“…RNA was also sent to a commercial vendor (Novogene Corp., Sacramento, CA, USA) for performance of RNA-seq analysis of global gene expression as previously described. Similar criteria were used to identify differentially expressed genes (DEG) between LNCaP and LNCaP-ProL1– cell-lines as described in the analysis of DEG in LNCaP compared to LNCaP-ProL1+ cell-lines as previously described (i.e., cut-off criteria for differentially expressed genes was >1 Log2FoldChange or <–1 Log2FoldChange in gene expression with a p -value < 0.01 [ 11 ]). Gene ontology (GO) annotation analysis of DEG was performed using online analysis tools available from the database for annotation, visualization and integrated discovery (DAVID, vers 6.8, Homo sapien GOTERM_GO_Direct database [ 27 , 28 ]).…”

Section: Methodsmentioning

confidence: 99%

“…In this regard, a growing body of evidence associates modulated expression of members of the opiorphin gene family (represented by PROL1, SMR3A and SMR3B) with several cancers [3][4][5][6][7][8][9][10], including a recently identified association between upregulated expression of PROL1 and PrCa [11]. The opiorphin genes encode peptides which act as potent endogenous neutral endopeptidase (NEP) inhibitors [12].…”

Section: Introductionmentioning

confidence: 99%

See 4 more Smart Citations

PROL1 is essential for xenograft tumor development in mice injected with the human prostate cancer cell-line, LNCaP, and modulates cell migration and invasion

Mukherjee¹,

Park²,

Davies³

2021

J. Mens. Health

Self Cite

View full text Add to dashboard Cite

Background and objective: A growing body of literature suggests modulated expression of members of the opiorphin family of genes (PROL1, SMR3A and SMR3B) is associated with cancer. Recently, overexpression of PROL1 was shown to be associated with prostate cancer, with evidence of a role in overcoming the hypoxic barrier that develops as tumors grow. The primary goal of the present studies was to support and expand evidence for a role of PROL1 in the development and progression of prostate cancer. Material and methods: We engineered knock-out of the opiorphin gene, PROL1, in LNCaP, an androgen-sensitive, human prostate cancer derived, cell-line. Using xenograft assays, we compared the ability of injected LNCaP PROL1 knock-out cell-lines to develop tumors in both castrated and intact male mice with the parental LNCaP and LNCaP PROL1 overexpressing cell-lines. We used RNAseq to compare global gene expression between the parental and LNCaP PROL1 knock-out cell-lines. Wound closure and 3D spheroid invasion assays were used to compare cell motility and migration between parental LNCaP cells and LNCaP cells overexpressing of PROL1. Results: The present studies demonstrate that LNCaP cell-lines with consisitutive knock-out of PROL1 fail to develop tumors when injected into both castrated and intact male mice. Using RNAseq to compare global gene expression between the parental and LNCaP PROL1 knock-out cell-lines, we confirmed a role for PROL1 in regulating molecular pathways associated with angiogenesis and tumor blood supply, and also identified a potential role in pathways related to cell motility and migration. Through the use of wound closure and 3D spheroid invasion assays, we confirmed that overexpression of PROL1 in LNCaP cells leads to greater cell motility and migration compared to parental cells, suggesting that PROL1 overexpression results in a more invasive phenotype. Conclusion: Overall, our studies add to the growing body of evidence that opiorphin-encoding genes play a role in cancer development and progression. PROL1 is essential for establishment and growth of tumors in mice injected with LNCaP cells, and we provide evidence that PROL1 has a possible role in progression towards a more invasive, metastatic and castration resistant prostate cancer (PrCa).

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

PROL1 is essential for xenograft tumor development in mice injected with the human prostate cancer cell-line, LNCaP, and modulates cell migration and invasion

Mukherjee¹,

Park²,

Davies³

2021

J. Mens. Health

Self Cite

View full text Add to dashboard Cite

show abstract

Global nutritional challenges of reformulated food: A review

Onyeaka

Nwaiwu

Obileke

et al. 2023

Food Science & Nutrition

View full text Add to dashboard Cite

Food reformulation, the process of redesigning processed food products to make them healthier, is considered a crucial step in the fight against noncommunicable diseases. The reasons for reformulating food vary, with a common focus on reducing the levels of harmful substances, such as fats, sugars, and salts. Although this topic is broad, this review aims to shed light on the current challenges faced in the reformulation of food and to explore different approaches that can be taken to overcome these challenges. The review highlights the perception of consumer risk, the reasons for reformulating food, and the challenges involved. The review also emphasizes the importance of fortifying artisanal food processing and modifying microbial fermentation in order to meet the nutrient requirements of people in developing countries. The literature suggests that while the traditional reductionist approach remains relevant and yields quicker results, the food matrix approach, which involves engineering food microstructure, is a more complex process that may take longer to implement in developing economies. The findings of the review indicate that food reformulation policies are more likely to succeed if the private sector collaborates with or responds to the government regulatory process, and further research is conducted to establish newly developed reformulation concepts from different countries. In conclusion, food reformulation holds great promise in reducing the burden of noncommunicable diseases and improving the health of people around the world.

show abstract