Role of Non-coding RNA in Diabetic Cardiomyopathy

Lu, Xin-Jiang; Song, Meiyi

doi:10.1007/978-981-15-1671-9_10

Cited by 15 publications

(11 citation statements)

References 105 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Diabetic cardiomyopathy is a common complication of diabetes. Due to metabolic disorders and microvascular lesions, diabetic cardiomyopathy leads to extensive focal myocardial necrosis and subclinical cardiac dysfunction, which eventually develops into heart failure, arrhythmia, cardiac shock and even sudden death in severe cases (1)(2)(3) Rutin is a flavonoid compound extracted from plants, and has been reported to exert antioxidant, anti-inflammatory, anti-allergic and anti-viral effects (4,5). Rutin is thought to act on multiple tissues and organs in the body.…”

Section: Introductionmentioning

confidence: 99%

Rutin alleviates cardiomyocyte injury induced by high glucose through inhibiting apoptosis and endoplasmic reticulum stress

Wang

et al. 2021

Exp Ther Med

View full text Add to dashboard Cite

Diabetic cardiomyopathy is a common complication of diabetes, in which endoplasmic reticulum stress (ERS) serves an important role. Rutin can treat the myocardial dysfunction of diabetic rats. However, to the best of our knowledge, studies on the effects of Rutin on myocardial injury caused by diabetes from the perspective of ERS have not previously been reported. In the present study, the role of rutin in the regulation of ERS in myocardial injury was assessed. Different high glucose concentrations were used to treat H9C2 myoblast cells to establish a myocardial damage model. A cell counting kit-8 assay was used to determine cell viability. A lactate dehydrogenase kit was used to detect cytotoxicity. Apoptosis levels were determined using a TUNEL assay. Western blotting was used to determine the expression levels of apoptosis-related proteins and ERS-related proteins, including heat shock protein A family member 5, inositol-requiring enzyme-1α, X-box binding protein 1, activating transcription factor 6, C/EBP-homologous protein (CHOP), cleaved caspase-12 and caspase-12. The anti-apoptotic and anti-ERS effects of Rutin on H9C2 cardiac cells induced by high glucose were examined after the administration of the ERS activator thapsigargin (TG). The results indicated that rutin could dose-dependently inhibit the level of apoptosis and ERS induced by high glucose in H9C2 cells. After administration of the ERS activator TG, it was demonstrated that TG could reverse the anti-apoptotic and anti-ERS effects of rutin on H9C2 cells stimulated with high glucose. Collectively, the present results suggested that rutin may alleviate cardiomyocyte model cell injury induced by high glucose through the inhibition of apoptosis and ERS.

show abstract

Section: Introductionmentioning

confidence: 99%

Rutin alleviates cardiomyocyte injury induced by high glucose through inhibiting apoptosis and endoplasmic reticulum stress

Wang

et al. 2021

Exp Ther Med

View full text Add to dashboard Cite

show abstract

“…Goat polyclonal anti-TAGLN [SM22α] antibodies were from AbCam Inc. (Cambridge MA, USA); mouse monoclonal, MG-H1, [1H7G5] antibodies were from Hycult Biotech (Wayne PA, USA); rabbit polyclonal Glo1 [FL-184] antibodies, actin [ 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 ] antibodies, donkey anti rabbit IgG-HRP, and donkey anti goat IgG-HRP were from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA); NF-κB p65 and phosphor-p65 (Ser536, NF-κB) were from Cell Signaling Technologies (Danves MA, USA); chicken anti-rabbit IgG coupled to Alexa Fluor 488, chicken-anti-mouse IgG coupled to Alexa Fluor 488, and donkey anti-goat IgG coupled to Alexa 594 were obtained from Invitrogen Life Technologies (Carlsbad, CA, USA); Fluoroshield with DAP1, bovine serum albumin labeled with fluorescein isothiocyanate (BSA-FITC), and the Trichrome (Masson) staining kit (Cat# HT15-1KT) were from Sigma-Aldrich, St Louis MO. Primers (TNF-α, sense, ATGAGCACTGAAAGCATGAT and antisense, CTCTTGATGGCAGAGAGGAG and β-actin, sense, CGTAAAGACCTCTATGCCA and antisense AGCCATGCCAAATGTCTCAT) were from Integrated DNA Technologies (Coralville, IA, USA).…”

Section: Methodsmentioning

confidence: 99%

“…In patients with Type 1 diabetes mellitus (T1DM), diabetic cardiomyopathy (DC) starts with an impairment in diastolic dysfunction and progresses to systolic dysfunction [ 2 , 3 , 4 , 5 ]. Increases in oxidative stress, inflammation, fibrosis, sympatho-excitation, activation of the renin-angiotensin system, impairment in myocyte intracellular Ca 2+ handling, mitochondrial dysfunction, and changes in miRNA composition have been identified as contributing causes of both diastolic and systolic dysfunctions [ 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 ]. Data from several recent studies suggest that the accumulation of the toxic glycolytic metabolic methylglyoxal (MG) may be an elusive cue that is responsible for the diverse pathobiologies seen in DC [ 14 , 15 , 16 , 17 , 18 ].…”

Section: Introductionmentioning

confidence: 99%

Adeno-Associated Viral Transfer of Glyoxalase-1 Blunts Carbonyl and Oxidative Stresses in Hearts of Type 1 Diabetic Rats

et al. 2020

View full text Add to dashboard Cite

Accumulation of methylglyoxal (MG) arising from downregulation of its primary degrading enzyme glyoxalase-1 (Glo1) is an underlying cause of diabetic cardiomyopathy (DC). This study investigated if expressing Glo1 in rat hearts shortly after the onset of Type 1 diabetes mellitus (T1DM) would blunt the development of DC employing the streptozotocin-induced T1DM rat model, an adeno-associated virus containing Glo1 driven by the endothelin-1 promoter (AAV2/9-Endo-Glo1), echocardiography, video edge, confocal imaging, and biochemical/histopathological assays. After eight weeks of T1DM, rats developed DC characterized by a decreased E:A ratio, fractional shortening, and ejection fraction, and increased isovolumetric relaxation time, E: e’ ratio, and circumferential and longitudinal strains. Evoked Ca2+ transients and contractile kinetics were also impaired in ventricular myocytes. Hearts from eight weeks T1DM rats had lower Glo1 and GSH levels, elevated carbonyl/oxidative stress, microvascular leakage, inflammation, and fibrosis. A single injection of AAV2/9 Endo-Glo1 (1.7 × 1012 viron particles/kg) one week after onset of T1DM, potentiated GSH, and blunted MG accumulation, carbonyl/oxidative stress, microvascular leakage, inflammation, fibrosis, and impairments in cardiac and myocyte functions that develop after eight weeks of T1DM. These new data indicate that preventing Glo1 downregulation by administering AAV2/9-Endo-Glo1 to rats one week after the onset of T1DM, blunted the DC that develops after eight weeks of diabetes by attenuating carbonyl/oxidative stresses, microvascular leakage, inflammation, and fibrosis.

show abstract

“…In short, small RNAs can regulate DCM pathogenesis through the aggravation of myocardial fibrosis, oxidative stress, apoptosis, cardiac electrical remodeling, or epigenetic modification (Table 2). Recent studies have identified that miRNAs play a vital role in the etiology of DCM (Guo and Nair, 2017;Xia and Song, 2020). By upregulating or downregulating different target genes, the same miRNA can play many roles in cardiomyocyte or myocardial fiber pathology (Xia and Song, 2020).…”

Section: Small Rnas In the Pathological Development Of Diabetic Cardiomyopathymentioning

confidence: 99%

Research Progress on Epigenetics of Diabetic Cardiomyopathy in Type 2 Diabetes

Deng

Liao

Jian-pin

et al. 2021

Front. Cell Dev. Biol.

View full text Add to dashboard Cite

Diabetic cardiomyopathy (DCM) is characterized by diastolic relaxation abnormalities in its initial stages and by clinical heart failure (HF) without dyslipidemia, hypertension, and coronary artery disease in its last stages. DCM contributes to the high mortality and morbidity rates observed in diabetic populations. Diabetes is a polygenic, heritable, and complex condition that is exacerbated by environmental factors. Recent studies have demonstrated that epigenetics directly or indirectly contribute to pathogenesis. While epigenetic mechanisms such as DNA methylation, histone modifications, and non-coding RNAs, have been recognized as key players in the pathogenesis of DCM, some of their impacts remain not well understood. Furthering our understanding of the roles played by epigenetics in DCM will provide novel avenues for DCM therapeutics and prevention strategies.

show abstract

Role of Non-coding RNA in Diabetic Cardiomyopathy

Cited by 15 publications

References 105 publications

Rutin alleviates cardiomyocyte injury induced by high glucose through inhibiting apoptosis and endoplasmic reticulum stress

Rutin alleviates cardiomyocyte injury induced by high glucose through inhibiting apoptosis and endoplasmic reticulum stress

Adeno-Associated Viral Transfer of Glyoxalase-1 Blunts Carbonyl and Oxidative Stresses in Hearts of Type 1 Diabetic Rats

Research Progress on Epigenetics of Diabetic Cardiomyopathy in Type 2 Diabetes

Contact Info

Product

Resources

About