Role of HtrA in Growth and Competence of Streptococcus mutans UA159

Abstract

We report here that HtrA plays a role in controlling growth and competence development for genetic transformation in Streptococcus mutans. Disruption of the gene for HtrA resulted in slow growth at 37°C, reduced thermal tolerance at 42°C, and altered sucrose-dependent biofilm formation on polystyrene surfaces. The htrA mutant also displayed a significantly reduced ability to undergo genetic transformation. A direct association between HtrA and genetic competence was demonstrated by the increased expression of the htrA gene upon exposure to competence-stimulating peptide. The induction of htrA gradually reached a maximum at around 20 min, suggesting that HtrA may be involved in a late competence response. Complementation of the htrA mutation in a single copy on the chromosome of the mutant could rescue the defective growth phenotypes but not transformability, apparently because a second gene, spo0J, immediately downstream of htrA, also affects transformation. The htrA and spo0J genes were shown to be both individually transcribed and cotranscribed and probably have a functional connection in competence development. HtrA regulation appears to be finely tuned in S. mutans, since strains containing multiple copies of htrA exhibited abnormal growth phenotypes. Collectively, the results reveal HtrA to be an integral component of the regulatory network connecting cellular growth, stress tolerance, biofilm formation, and competence development and reveal a novel role for the spo0J gene in genetic transformation.

Genetic characterization of the hdrRM operon: a novel high-cell-density-responsive regulator in Streptococcus mutans

“…While there are numerous examples of mutations that lower the natural competence ability of S. mutans (Abranches et al, 2006;Ahn et al, 2005;Hussain et al, 2006;Merritt et al, 2005c;Qi et al, 2004;Rolerson et al, 2006;Senadheera et al, 2005Senadheera et al, , 2007Wang & Kuramitsu, 2006;Wen et al, 2005), to our knowledge, there is only one other report of a mutation that increases natural competence (Tao et al, 1993). This mutation was generated by chemical mutagenesis and its identity has, so far, not been published.…”

The atlA Operon of Streptococcus mutans : Role in Autolysin Maturation and Cell Surface Biogenesis

“…To construct a reporter gene fusion for measuring the transcription from the 5Ј regions of atlA, pepT, and thmA, fragments containing the putative promoter regions of these genes were cloned into the EcoRI and BamHI sites in front of a promoterless chloramphenicol acetyltransferase (CAT) gene (cat) in pGEM3cat (1). The gene fusions were released using EcoRI and HindIII digestion, treated with T4 DNA polymerase, and then cloned into the integration vector pBGK2 (81,82) at the SmaI site.…”

“…Plasmids were digested with BamHI and ligated to a nonpolar (NPKm) or polar (⍀Km) kanamycin cassette from pALH124 or pVT924, respectively, that was digested with the same enzyme (2). Also, a plasmid was digested with BamHI, bluntended with T4 DNA polymerase, and replaced by a polar erythromycin cassette (Em r ) gene (1). The mutagenic plasmids were used to transform S. mutans UA159 or 630NP, which carries a nonpolar deletion/insertion in the atlA gene (10).…”

“…Levels of pepT and thmA mRNA were quantified by real-time RT-PCR. Extraction of RNA, RT-PCR, and real-time RT-PCR were performed as previously described (1). The primers used for reverse transcription reactions and real-time PCR are shown in Table 1.…”

Characterization of Staphylococcus spp. strains in milk from buffaloes with mastitis in Brazil: the need to identify to species level to avoid misidentification

“…The ability of the isolates to produce biofilm was analyzed as described by Ahn, et al (2005) using S. epidermidis ATCC 35984 as positive and S. epidermidis ATCC 12228 as negative controls. The experiments were performed in triplicate and classified according to Stepanovic et al, 2007. The primers used were: mecA MRS1 (5' TAGAAATGACTGAACGTCCG 3') and MRS2 (5' TTGCGATCAATGTTACCGTAG 3') (Santos et al, 1999); icaA Forward (5' CGATGGGCTCAAGGTGG 3') and icaA Reverse (5' TTCTTTTCGTAGCGACTGTC 3') for the gene icaA, and bap2 Forward (5' GAGCCAGATAAACAACAAGAAG 3') and bap2 Reverse (5' CATGCTCAGCAATAATTGGATC 3') (Potter et al, 2009 (5'GAGTTTGATCCTGGCTCAG 3') and 1492r (5'…”