Role of conformational heterogeneity in ligand recognition by viral RNA molecules

Levintov, Lev; Vashisth, Harish

doi:10.1039/d1cp00679g

Cited by 9 publications

(14 citation statements)

References 77 publications

(121 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…As described above, capitalization of these low abundant RNA conformations with small molecules could provide a novel approach in RNA therapeutics for currently incurable diseases. 11,[89][90][91] Thus, structural knowledge of such short-lived conformations is pivotal to utilize this new approach so that one can make use of transient RNA states in drug design. In this contribution, we combined advanced computational techniques with NMR spectroscopy to provide structural insights on highly dynamic 2×2 GG/GG and 2×2 CC/CC internal loop motifs observed in RNA G4C2 and C4G2 repeat expansions causing c9ALS/FTD.…”

Section: Discussionmentioning

confidence: 99%

Conformational Dynamics of RNA G4C2 and C2G4 Repeat Expansions causing ALS/FTD using NMR and Molecular Dynamics Studies

Disney

Taghavi

Baisden

et al. 2023

Preprint

View full text Add to dashboard Cite

RNA G4C2 and C4G2 repeat expansions in the chromosome 9 open reading frame 72 gene (C9orf72) are the most common cause of genetically defined amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), referred to as c9ALS/FTD. The gene is bidirectionally transcribed, producing G4C2 repeats, r(G4C2)exp, in the sense and C4G2 repeats, r(C4G2)exp, in the antisense strands. Akin to other repeat expansions, those operating in c9ALS/FTD are highly structured, which contributes to their gain-of-function mechanism. Structural studies have revealed that r(G4C2)exp predominantly folds into a hairpin, which has periodic arrays of 1×1 G/G internal loops and a G-quadruplex. Recent studies on small molecule probes revealed that r(G4C2)exp adopts a new hairpin structure in which the 1×1 G/G internal loops transform into 2×2 GG/GG internal loops. We first evaluated the performance of four different RNA force fields with conventional MD simulations and showed that only the one having revised χ and α/γ torsional parameters maintained the helicity of a model r(G4C2)2. We then used this force field to study the conformational dynamics adopted by 2×2 GG/GG loops in a model system of r(UCUGGGGCCAGA)2 using temperature replica exchange molecular dynamics (T-REMD) simulations covering over 1.7 ms cumulative simulation time. We further characterized the structure and underlying dynamics of these internal loops using traditional 2D NMR techniques, illustrating the possibility of adopting different configurations around the glycosidic bond, i.e., anti vs. syn, using a hairpin model, r(CCAGGGCAAGGAAACUUGGGCUGG). Results display that closing base pairs play an important role in the structure and dynamics of these systems with the most preferred configuration being in syn-anti/anti-syn and anti-syn/anti-syn. Analogous studies on r(C4G2) repeats, which fold into an array of 2×2 CC/CC internal loops, revealed that this structure is not as dynamic as 2×2 GG/GG internal loops, where the residues adopt all anti configurations, although the dynamics of the loop residues is affected by the closing base pairs. Collectively, these studies emphasize the unique sensitivity of r(G4C2)exp to small changes in stacking interactions, which is not observed in r(C4G2)exp, providing important considerations for further principles in structure-based drug design.

show abstract

Section: Discussionmentioning

confidence: 99%

Conformational Dynamics of RNA G4C2 and C2G4 Repeat Expansions causing ALS/FTD using NMR and Molecular Dynamics Studies

Disney

Taghavi

Baisden

et al. 2023

Preprint

View full text Add to dashboard Cite

show abstract

“…In conclusion, MD simulations approaches are valuable tools to predict the pose and affinity of ligands targeting RNA along with RNA structural plasticity in response to ligand binding [ 106 , 108 ]. The latter is crucial to identify binding pockets that can be exploited for drug design [ 110 ].…”

Section: Discussionmentioning

confidence: 99%

“…The studies above, along with many other NMR studies [ 95 , 97 , 98 , 99 , 100 , 101 , 102 , 103 , 104 ], showed that TAR binds to Tat mimics and other small ligands and peptides mostly through its “bulge” (consisting of single stranded nucleotides) with nucleotides n 23–25 ( Figure 3 A) separating the bulge from the following two helical regions (“upper” and “lower” stems) and that these ligands mostly bind selecting sparsely populated but pre-existing conformations. These studies also showed that conformational fluctuations sustain and assist ligand binding [ 19 ] and that the binding of proteins and small molecules alter dramatically the structure and the distribution of ions around the RNA molecule [ 105 , 106 ].…”

Section: Targeting Hiv-1 Tar Rna Hairpinmentioning

confidence: 99%

Role and Perspective of Molecular Simulation-Based Investigation of RNA–Ligand Interaction: From Small Molecules and Peptides to Photoswitchable RNA Binding

et al. 2021

View full text Add to dashboard Cite

Aberrant RNA–protein complexes are formed in a variety of diseases. Identifying the ligands that interfere with their formation is a valuable therapeutic strategy. Molecular simulation, validated against experimental data, has recently emerged as a powerful tool to predict both the pose and energetics of such ligands. Thus, the use of molecular simulation may provide insight into aberrant molecular interactions in diseases and, from a drug design perspective, may allow for the employment of less wet lab resources than traditional in vitro compound screening approaches. With regard to basic research questions, molecular simulation can support the understanding of the exact molecular interaction and binding mode. Here, we focus on examples targeting RNA–protein complexes in neurodegenerative diseases and viral infections. These examples illustrate that the strategy is rather general and could be applied to different pharmacologically relevant approaches. We close this study by outlining one of these approaches, namely the light-controllable association of small molecules with RNA, as an emerging approach in RNA-targeting therapy.

show abstract

“…The wealth of high-quality and consistent structural data available demonstrates beyond a reasonable doubt that there exists a stable thermally accessible active site structure where G40 is in a position to act as general base. Nonetheless, RNA is known to exhibit a high degree of conformational heterogeneity, [54][55][56][57] and the active state of ribozymes capable of performing catalysis are often not the most probable ground states in solution. 18,31,32,58 Simulation results presented here support the supposition that there exists a plausible alternative active site structure that positions G42 as the general base, fits the L-platform/L-scaffold framework and has a catalytically relevant occupancy in solution.…”

Section: Organic and Biomolecular Chemistry Papermentioning

confidence: 99%

Who stole the proton? Suspect general base guanine found with a smoking gun in the pistol ribozyme

Ekesan

York

2022

Org. Biomol. Chem.

View full text Add to dashboard Cite

show abstract

Role of conformational heterogeneity in ligand recognition by viral RNA molecules

Abstract: Ribonucleic acid (RNA) molecules are known to undergo conformational changes in response to various environmental stimuli including temperature, pH, and ligands. In particular, viral RNA molecules are a key example...

Cited by 9 publications

References 77 publications

Conformational Dynamics of RNA G4C2 and C2G4 Repeat Expansions causing ALS/FTD using NMR and Molecular Dynamics Studies

Conformational Dynamics of RNA G4C2 and C2G4 Repeat Expansions causing ALS/FTD using NMR and Molecular Dynamics Studies

Role and Perspective of Molecular Simulation-Based Investigation of RNA–Ligand Interaction: From Small Molecules and Peptides to Photoswitchable RNA Binding

Who stole the proton? Suspect general base guanine found with a smoking gun in the pistol ribozyme

Contact Info

Product

Resources

About