Role for RACK1 Orthologue Cpc2 in the Modulation of Stress Response in Fission Yeast

Núñez, Andrés; Franco, Alejandro; Madrid, Marisa; Soto, Teresa; Vicente, Jero; Gacto, Mariano; Cansado, José

doi:10.1091/mbc.e09-05-0388

Cited by 39 publications

(42 citation statements)

References 53 publications

(95 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…24 This model places eIF6 activity downstream of the growth factor/PKC signaling cascade and explains observations indicating that eIF6 can repress translation in vitro but not in vivo when ras/PKC stimulation is performed (see below). The model fits data showing that PKC binds RACK1, [25][26][27] and its stimulation regulates translation in many conditions. 25,28,29 However, although RACK1 binds cytoplasmic 40S subunits, its location at the mRNA exit channel of 40S places it far from the intersubunit bridges, 24 and PKC signaling is not evolutionarily conserved in yeasts.…”

Section: S Formation and Diseasesupporting

confidence: 52%

Translational control by 80S formation and 60S availability: The central role of eIF6, a rate limiting factor in cell cycle progression and tumorigenesis

Brina¹,

Grosso²,

Miluzio³

et al. 2011

Cell Cycle

View full text Add to dashboard Cite

Section: S Formation and Diseasesupporting

confidence: 52%

Translational control by 80S formation and 60S availability: The central role of eIF6, a rate limiting factor in cell cycle progression and tumorigenesis

Brina¹,

Grosso²,

Miluzio³

et al. 2011

Cell Cycle

View full text Add to dashboard Cite

“…Total RNA preparations were obtained as described previously and resolved through 1.5% agaroseformaldehyde gels. Northern (RNA)-hybridization analyses were performed as reported earlier (22). The probes employed were amplified by PCR and included a 0.8-kbp fragment of the wee1 ϩ gene that was amplified with the 5Ј oligonucleotide TCTCTCCATTTGCATCGGGC and the 3Ј oligonucleotide AGGAGGAGGATCGAACCTCA; a 1.5-kbp fragment of the nim1 ϩ gene amplified with the 5Ј oligonucleotide GGGACG-TCTATTTTGATTGCC and the 3Ј oligonucleotide ATGGT-GAAGCGACACAAAAAT; a 1.2-kbp fragment of the cdr2 ϩ gene amplified with the 5Ј oligonucleotide GGACGGATTG-TCGTTGACGA and the 3Ј oligonucleotide AGCAGCATCC-AACGGGC; and a 1-kbp fragment of the leu1 ϩ gene amplified with the 5Ј oligonucleotide TCGTCGTCTTACCAGGAG and the 3Ј oligonucleotide CAACAGCCTTAGTAATAT.…”

Section: Gene Disruption and Epitope Tagging-the Cpc2mentioning

confidence: 99%

“…1A) (21,22). In eukaryotic cells, Cdk1/Cdc2 kinase activity is down-regulated during G 2 phase of the cell cycle by phosphorylation at Tyr 15 (2).…”

Section: Cpc2 Positively Regulates G 2 /M Transition During the Cellmentioning

confidence: 99%

“…Cpc2, the fission yeast RACK1 ortholog, was identified through its action on protein kinase Ran1/Pat1, which controls the transition from mitosis to meiosis (21). Mutants lacking Cpc2 show several characteristic phenotypes like defective sexual differentiation under nitrogen deprivation and sensitivity to different stresses (21,22). Interestingly, RACK1/Cpc2 proteins are structural components of the 40 S ribosomal subunit (23)(24)(25)(26)(27), located in the proximity of the mRNA exit channel and in close contact with the binding surface of the eIF3 complex (27).…”

mentioning

confidence: 99%

“…Interestingly, RACK1/Cpc2 proteins are structural components of the 40 S ribosomal subunit (23)(24)(25)(26)(27), located in the proximity of the mRNA exit channel and in close contact with the binding surface of the eIF3 complex (27). In this context, we have recently described that in fission yeast Cpc2 functions from the ribosome by positively regulating the translation of specific mRNAs, like those encoding Pyp1 and Pyp2 tyrosine phosphatases, which control the magnitude of the activation of Pmk1 and Sty1 MAPKs, and the function of transcription factor Atf1, which regulates the global transcriptional response against stress (22). These results support that RACK1/Cpc2 may provide a platform for the translation of specific subsets of mRNAs involved in key cellular processes (22,25).…”

mentioning

confidence: 99%

See 2 more Smart Citations

Fission Yeast Receptor of Activated C Kinase (RACK1) Ortholog Cpc2 Regulates Mitotic Commitment through Wee1 Kinase

Núñez¹,

Franco²,

Soto

et al. 2010

Journal of Biological Chemistry

Self Cite

View full text Add to dashboard Cite

In the fission yeast Schizosaccharomyces pombe, Wee1-dependent inhibitory phosphorylation of the highly conserved Cdc2/Cdk1 kinase determines the mitotic onset when cells have reached a defined size. The receptor of activated C kinase (RACK1) is a scaffolding protein strongly conserved among eukaryotes which binds to other proteins to regulate multiple processes in mammalian cells, including the modulation of cell cycle progression during G 1 /S transition. We have recently described that Cpc2, the fission yeast ortholog to RACK1, controls from the ribosome the activation of MAPK cascades and the cellular defense against oxidative stress by positively regulating the translation of specific genes whose products participate in the above processes. Intriguingly, mutants lacking Cpc2 display an increased cell size at division, suggesting the existence of a specific cell cycle defect at the G 2 /M transition. In this work we show that protein levels of Wee1 mitotic inhibitor are increased in cells devoid of Cpc2, whereas the levels of Cdr2, a Wee1 inhibitor, are down-regulated in the above mutant. On the contrary, the kinetics of G 1 /S transition was virtually identical both in control and Cpc2-less strains. Thus, our results suggest that in fission yeast Cpc2/RACK1 positively regulates from the ribosome the mitotic onset by modulating both the protein levels and the activity of Wee1. This novel mechanism of translational control of cell cycle progression might be conserved in higher eukaryotes.Cell reproduction involves the passing through a series of events collectively known as the cell cycle, which consists of alternative stages involving DNA replication (S phase), chromosome segregation and nuclear division (mitosis), as well as cell division (cytokinesis). Entry into mitosis is induced by the activation of a cyclin B-bound Cdc2/Cdk1 kinase, which is highly conserved among eukaryotic cells (1). In the fission yeast Schizosaccharomyces pombe, the inhibitory phosphorylation at a conserved tyrosine 15 (Tyr 15 ) in Cdc2 regulates its kinase activity that determines the mitotic onset and the start of division when the cells have reached a defined size (2). The kinase Wee1 down-regulates Cdc2 by inhibitory Tyr 15 phosphorylation, which is reversed by Cdc25 phosphatase, leading to Cdc2 activation and triggering of mitotic entry (3-6). Consequently, fission yeast cells lacking Wee1 activity enter mitosis before reaching a critical size to produce two small daughter cells (7). On the contrary, mutants in Cdc25 enter mitosis at an increased cell size, indicating that the activities/levels of both Cdc25 and Wee1 must be tightly regulated to provide an accurate control of the mitotic onset. In fission yeast, Wee1 is in turn phosphorylated and its activity negatively regulated by two SAD family kinases, Nim1 (also known as Cdr1 (8 -12) and Cdr2 (13,14). Recently, it has been described that gradients from the cell ends involving the DYRK family kinase Pom1 play a key role in the control of the progression of the cell cycle b...

show abstract

Current awareness on yeast

2010

Yeast

View full text Add to dashboard Cite

In order to keep subscribers up‐to‐date with the latest developments in their field, this current awareness service is provided by John Wiley & Sons and contains newly‐published material on yeasts. Each bibliography is divided into 10 sections. 1 Reviews; 2 General; 3 Biochemistry; 4 Biotechnology; 5 Cell Biology; 6 Gene Expression; 7 Genetics; 8 Physiology; 9 Medical Mycology; 10 Recombinant DNA Technology. Within each section, articles are listed in alphabetical order with respect to author. If, in the preceding period, no publications are located relevant to any one of these headings, that section will be omitted. (4 weeks journals ‐ search completed 31st. Dec. 2009)

show abstract

Role for RACK1 Orthologue Cpc2 in the Modulation of Stress Response in Fission Yeast

Cited by 39 publications

References 53 publications

Translational control by 80S formation and 60S availability: The central role of eIF6, a rate limiting factor in cell cycle progression and tumorigenesis

Translational control by 80S formation and 60S availability: The central role of eIF6, a rate limiting factor in cell cycle progression and tumorigenesis

Fission Yeast Receptor of Activated C Kinase (RACK1) Ortholog Cpc2 Regulates Mitotic Commitment through Wee1 Kinase

Current awareness on yeast

Contact Info

Product

Resources

About