Robust Generation of Knock-in Cell Lines Using CRISPR-Cas9  and rAAV-assisted Repair Template Delivery

Vandemoortele, Giel; Sutter, Delphine De; Eyckerman, Sven

doi:10.21769/bioprotoc.2211

Cited by 4 publications

(6 citation statements)

References 10 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…All primers used in this manuscript can be found in Table S1. Homology regions were generated by PCR on genomic HCT116 DNA as described before. , The pMet7-FLAG-PQS1-TP53-T2A-BirA*-Myc construct was generated by standard restriction enzyme cloning procedures using the FLAG-PQS1-p53 expression vector published earlier . This construct was further mutagenized by PCR to obtain a construct bearing an inactivated T2A sequence for a BioID transient transfection experiment.…”

Section: Methodsmentioning

confidence: 99%

“…HCT116 TP53 +/T2A‑BirA* cells were generated using a combination of CRISPR/Cas9 and recombinant Adeno-associated virus (rAAV)-mediated template delivery as described before. , Briefly, a TP53 C-terminal targeted gRNA (5′ ACGCACACCUAUUGCAAGCA 3′) was cloned in a Cas9 expression construct (Addgene no. 48139) as described by Ran et al Cells were seeded in a 24-well plate 24 h before transfection with the Cas9 plasmid using FugeneHD (Promega, E2311).…”

Section: Methodsmentioning

confidence: 99%

“…Additionally, Southern blot analysis was performed to verify single genomic integration of the floxed neomycin resistance cassette. A [α- 32 P] Southern blot probe was generated as described before . For every retained clone, engineered loci were verified using Sanger sequencing as described earlier.…”

Section: Methodsmentioning

confidence: 99%

See 2 more Smart Citations

A Well-Controlled BioID Design for Endogenous Bait Proteins

et al. 2018

Self Cite

View full text Add to dashboard Cite

The CRISPR/Cas9 revolution is profoundly changing the way life sciences technologies are used. Many assays now rely on engineered clonal cell lines to eliminate the overexpression of bait proteins. Control cell lines are typically nonengineered cells or engineered clones, implying a considerable risk for artifacts because of clonal variation. Genome engineering can also transform BioID, a proximity labeling method that relies on fusing a bait protein to a promiscuous biotin ligase, BirA*, resulting in the tagging of vicinal proteins. We here propose an innovative design to enable BioID for endogenous proteins wherein we introduce a T2A-BirA* module at the C-terminus of endogenous p53 by genome engineering, leading to bicistronic expression of both p53 and BirA* under control of the endogenous promoter. By targeting a Cas9cytidine deaminase base editor to the T2A autocleavage site, we can efficiently derive an isogenic population expressing a functional p53-BirA* fusion protein. Using quantitative proteomics we show significant benefits over the classical ectopic expression of p53-BirA*, and we provide a first well-controlled view of the proximal proteins of endogenous p53 in colon carcinoma cells. This novel application for base editors expands the CRISPR/ Cas9 toolbox and can be a valuable addition for synthetic biology.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

A Well-Controlled BioID Design for Endogenous Bait Proteins

et al. 2018

Self Cite

View full text Add to dashboard Cite

show abstract

“…After 72 hours, a limiting dilution was performed and single cells were transferred in a 96-well plate. Clones were expanded and one heterozygous HCT116 WT/BioID clone for each cell line was selected following a PCR screening in the 96-well plate as previously described [81].…”

Section: Generation Of Ko Cell Linesmentioning

confidence: 99%

Endogenous TOM20 Proximity Labelling: A Swiss-Knife for the Study of Mitochondrial Proteins in Human Cells

Meurant¹,

Mauclet²,

Dieu³

et al. 2023

Preprint

View full text Add to dashboard Cite

Biotin-based proximity labeling approaches, such as BioID, have demonstrated their use for the study of mitochondria proteomes in living cells. The use of genetically engineered BioID cell lines enables the detailed characterization of poorly characterized processes such as mitochondrial co-translational import. In this process, translation is coupled to the translocation of the mitochon-drial proteins, alleviating the energy cost typically associated with the post-translational import relying on chaperone systems. However, the mechanisms are still unclear with only few actors identified but none that have been described in mammals yet. We thus profiled the TOM20 prox-isome using BioID, assuming that some of identified proteins could be molecular actors of the co-translational import in human cells. The obtained results showed a high enrichment of RNA bind-ing proteins close to the TOM complex. However, for the few selected candidates, we could not demonstrate a role in the mitochondrial co-translational import process. Nonetheless, we were able to demonstrate additional uses of our BioID cell line. Indeed, the experimental approach used in this study is thus proposed for the identification of mitochondrial co-translational import effec-tors and for the monitoring of protein entry inside mitochondria with a potential application in the prediction of mitochondrial protein half-life.

show abstract

“…After 72 hours, a limiting dilution was performed and single cells transferred in a 96-well plate. Clones were expanded and one heterozygous HCT116 WT/BioID clone for each cell line was selected following a PCR screening in the 96-well plate as previously described [65].…”

Section: Generation Of Endogenous Bioid Cell Linesmentioning

confidence: 99%

Endogenous TOM20 Proximity Labelling: A Swiss-Knife for the Study of Mitochondrial Proteins in Human Cells

Meurant¹,

Mauclet²,

Dieu³

et al. 2022

Preprint

View full text Add to dashboard Cite

The majority of mitochondrial proteins are encoded by the nuclear genome and must be imported into the mitochondria. There are two main paths for mitochondrial protein import: post-translational and co-translational import. Co-translational import couples the translation and the translocation of the mitochondrial proteins, alleviating the energy cost typically associated with the post-translational import relying on chaperone systems. The mitochondrial co-translational import mechanisms are still unclear with few actors identified but none have been described in mammals yet. We thus profiled the TOM20 proxisome using BioID, assuming that some of identified proteins could be molecular actors of the co-translational import in human cells. The obtained results showed a high enrichment of RNA binding proteins close to the TOM complex. However, for the few selected candidates, we could not demonstrate a role in the mitochondrial co-translational import process. Nonetheless, we were able to demonstrate a new mitochondrial localization for nuclear proteins. Besides, additional analyses revealed a negative correlation between the abundance of mitochondrial proteins and their reported half-life. This experimental approach is thus proposed to potentially characterize mitochondrial co-translational import effectors in human cells and to monitor protein entry inside mitochondria with a potential application in the prediction of mitochondrial protein half-life.

show abstract

Robust Generation of Knock-in Cell Lines Using CRISPR-Cas9 and rAAV-assisted Repair Template Delivery

Cited by 4 publications

References 10 publications

A Well-Controlled BioID Design for Endogenous Bait Proteins

A Well-Controlled BioID Design for Endogenous Bait Proteins

Endogenous TOM20 Proximity Labelling: A Swiss-Knife for the Study of Mitochondrial Proteins in Human Cells

Endogenous TOM20 Proximity Labelling: A Swiss-Knife for the Study of Mitochondrial Proteins in Human Cells

Contact Info

Product

Resources

About