RNA2 of grapevine fanleaf virus: sequence analysis and coat protein cistron location

Abstract

The nucleotide sequence of the genomic RNA2 (3774 nucleotides) of grapevine fanleaf virus strain F13 was determined from overlapping cDNA clones and its genetic organization was deduced. Two rapid and efficient methods were used for cDNA cloning of the 5' region of RNA2. The complete sequence contained only one long open reading frame of 3555 nucleotides (1184 codons, 131K product). The analysis of the Nterminal sequence of purified coat protein (CP) and identification of its C-terminal residue have allowed the CP cistron to be precisely positioned within the polyprotein. The CP produced by proteolytic cleavage at the Arg/Gly site between residues 680 and 681 contains 504 amino acids (Mr 56019) and has hydrophobic properties. The Arg/Gly cleavage site deduced by N-terminal amino acid sequence analysis is the first for a nepovirus coat protein and for plant viruses expressing their genomic RNAs by polyprotein synthesis. Comparison of GFLV RNA2 with M RNA of cowpea mosaic comovirus and with RNA2 of two closely related nepoviruses, tomato black ring virus and Hungarian grapevine chrome mosaic virus, showed strong similarities among the 3' non-coding regions but less similarity among the 5' end non-coding sequences than reported among other nepovirus RNAs.

Grapevine fanleaf nepovirus P38 putative movement protein is not transiently expressed and is a stable final maturation product in vivo

“…1 a). The cleavages occur at the Cys257/Ala 258 and Arg6°5/Gly 6°6 sites between P28/P38 and P38/CP respectively Serghini et al, 1990 Biologically active full-length transcripts of RNA2 (clone pACN) and RNAI (clone pMV) have been obtained (Viry et al, 1993) which allowed us to demonstrate that GFLV RNA1 can autoreplicate in protoplasts and thus encodes the viral replication functions. In contrast RNA2, which requires for its replication the functions encoded by RNA1, is needed for virus spread in plants and thus encodes functions necessary for viral movement (Viry et al, 1993).…”

“…1 a). The cleavages occur at the Cys257/Ala 258 and Arg6°5/Gly 6°6 sites between P28/P38 and P38/CP respectively Serghini et al, 1990). …”

“…Its genetic information is divided over two plus-stranded RNA molecules: RNA1 (7342 nt) (Ritzenthaler et al, 1991) encodes a 253 kDa polyprotein (P1) and RNA2 (3774nt) (Serghini et al, 1990) encodes a 122kDa polyprotein (P2). In vitro both polyproteins are proteolytically processed by the RNAl-encoded 24 kDa chymotrypsin-like cysteine proteinase (Margis & Pinck, 1992;Margis et al, 1991).…”

Molecular Characterization of Phylogenetically Distinct Isolates of Grapevine fanleaf virus from Iran Based on 2AHP Gene

“…VPg, proteinase and RNA-dependent RNA polymerase (RDRP) are the RNA1-encoded proteins. RNA2 codes for a protein (2A HP ) which is required for RNA2 replication and could act as homing protein [10], the movement protein (2B MP ) which is the constituent protein of tubules observed in plasmodesmata [27], and the coat protein (2C CP ) [32]. The complete RNA 1 (7,342 nt) for strain F13 [27], the RNA2 (3,774 nt) for strain F13 [32] and the German isolates, NW [40] have been sequenced.…”

“…In PCR reactions, two combinations of primers, 5 0 NC/G0 or 5 0 NC/GMPR1, were used. 5 0 NC (5 0 CCAAGAGTTT(A/G)(A/G)GAAACTCA3 0 ) and G0 (5 0 CAGAATTCCCTTACCCTCTC3 0 ) corresponding to nucleotides (nts) 109-128 and 881-900 of GFLV-F13 [32] were designed by [40] as the forward and reverse primers, respectively. Amplification by these primers was expected to produce a 792 bp fragment encompassing 126 nts of 5 0 UTR and 668 nts of 5 0 proximity of 2A HP gene located on the virus RNA2 segment.…”