RNA binding protein 24 regulates the translation and replication of hepatitis C virus

Huang, Cao; Zhao, Kaitao; Yao, Yongxuan; Guo, Jing; Gao, Xiaoxiao; Yang, Qi; Guo, Min; Zhu, Wandi; Wang, Yun; Wu, Chunchen; Chen, Jizheng; Zhou, Yuan; Lu, Mengji; Chen, Xinwen; Pei, Rongjuan

doi:10.1007/s13238-018-0507-x

Cited by 21 publications

(32 citation statements)

References 62 publications

(81 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…To reveal the function of RBM24 in HBV replication, HepG2.2.15 cells, which contain an integrated HBV (subtype ayw ) genome and stably express HBV driven by endogenous HBV promoters and enhancer elements, were transfected with RBM24-specific small interfering RNA (siRNA) 18 or nonspecific siNC. Knockdown of RBM24 led to a significant reduction in HBV DNA and all transcripts, including the 3.5-kb viral pgRNA, compared with siNC-transfected cells (Fig.…”

Section: Resultsmentioning

confidence: 99%

“…RIP assays were performed using a previously described method 18 , 51 . In brief, HEK293T cells were co-transfected with pHY106 and pHA-RBM24, pHA-ΔRNP1/2, pHA-ΔRNP1, or pHA-ΔRNP2, and cell lysates were harvested at 48 h post-transfection (hpt).…”

Section: Methodsmentioning

confidence: 99%

“…Recent reports have shown that RBM24 can post-transcriptionally regulate the stability of transcriptional factor p53 family members, such as p63 mRNA and p21 mRNA, through its RRM 16 , 17 , further suggesting the importance of RBM24 in RNA biology. Data from our group indicate that RBM24 can modulate hepatitis C virus (HCV) translation and replication, implying that RBM24 may participate in viral replication 18 . Considering that HBV transcripts are typical mRNAs produced by host RNA polymerase II 19 , in which pgRNA is an essential replication intermediate, it is possible that RBM24 is involved in HBV replication via interacting with these viral transcripts.…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

RBM24 stabilizes hepatitis B virus pregenomic RNA but inhibits core protein translation by targeting the terminal redundancy sequence

Yao

Yang

Huang

et al. 2018

Emerging Microbes & Infections

Self Cite

View full text Add to dashboard Cite

The terminal redundancy (TR) sequence of the 3.5-kb hepatitis B virus (HBV) RNA contains sites that govern many crucial functions in the viral life cycle, including polyadenylation, translation, RNA packaging, and DNA synthesis. In the present study, RNA-binding motif protein 24 (RBM24) is shown to be involved in the modulation of HBV replication by targeting the TR of HBV RNA. In HBV-transfected hepatoma cell lines, both knockdown and overexpression of RBM24 led to decreased HBV replication and transcription. Ectopic expression of RBM24 inhibited HBV replication, which was partly restored by knockdown of RBM24, indicating that a proper level of RBM24 was required for HBV replication. The regulation of RBM24 of HBV replication and translation was achieved by the interaction between the RNA-binding domains of RBM24 and both the 5′ and 3′ TR of 3.5-kb RNA. RBM24 interacted with the 5′ TR of HBV pregenomic RNA (pgRNA) to block 80S ribosome assembly on HBV pgRNA and thus inhibited core protein translation, whereas the interaction between RBM24 and the 3′ TR enhanced the stability of HBV RNA. Finally, the regulatory function of RBM24 on HBV replication was further confirmed in a HBV infection model. In conclusion, the present study demonstrates the dual functions of RBM24 by interacting with different TRs of viral RNA and reveals that RBM24 is an important host gene for HBV replication.

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

RBM24 stabilizes hepatitis B virus pregenomic RNA but inhibits core protein translation by targeting the terminal redundancy sequence

Yao

Yang

Huang

et al. 2018

Emerging Microbes & Infections

Self Cite

View full text Add to dashboard Cite

show abstract

“…By that, these proteins can be assumed to build a large network of RNA-protein and protein-protein interactions that connects the HCV RNA genome 5´-and 3´-ends, supported by direct binding of the 40S subunit and eIF3 to both the 5´-and 3´-regions (see above, and Figure 7). Proteins involved in this network which directly bind to the HCV RNA are La [197], NSAP1 [198], hnRNP L [199] and D [200], IMP1 [156], PCBP2 [201], the Lsm1-7 complex, and the negatively acting Gemin5 [196,202], and perhaps also PTB [203,204] and RBM24 [205]. Interestingly, the above proteins bind to many sites on the HCV plus strand RNA, but the very 3´end of the genomic RNA is not covered, suggesting that the 3´end is left available for the initiation of RNA minus strand synthesis by the NS5B replicase, likely supported by the NFAR proteins [206].…”

Section: Ires Trans-acting Factors (Itafs)mentioning

confidence: 99%

Hepatitis C Virus Translation Regulation

Niepmann

Gerresheim

2020

IJMS

View full text Add to dashboard Cite

Translation of the hepatitis C virus (HCV) RNA genome is regulated by the internal ribosome entry site (IRES), located in the 5’-untranslated region (5′UTR) and part of the core protein coding sequence, and by the 3′UTR. The 5′UTR has some highly conserved structural regions, while others can assume different conformations. The IRES can bind to the ribosomal 40S subunit with high affinity without any other factors. Nevertheless, IRES activity is modulated by additional cis sequences in the viral genome, including the 3′UTR and the cis-acting replication element (CRE). Canonical translation initiation factors (eIFs) are involved in HCV translation initiation, including eIF3, eIF2, eIF1A, eIF5, and eIF5B. Alternatively, under stress conditions and limited eIF2-Met-tRNAiMet availability, alternative initiation factors such as eIF2D, eIF2A, and eIF5B can substitute for eIF2 to allow HCV translation even when cellular mRNA translation is downregulated. In addition, several IRES trans-acting factors (ITAFs) modulate IRES activity by building large networks of RNA-protein and protein–protein interactions, also connecting 5′- and 3′-ends of the viral RNA. Moreover, some ITAFs can act as RNA chaperones that help to position the viral AUG start codon in the ribosomal 40S subunit entry channel. Finally, the liver-specific microRNA-122 (miR-122) stimulates HCV IRES-dependent translation, most likely by stabilizing a certain structure of the IRES that is required for initiation.

show abstract

“…La antigen interacts with the 5= UTR of the HCV RNA genome and enhances HCV IRES-dependent translation (13). Besides, eIF3, PTB, hnRNP L, and HMGB1 have been reported to bind to the 5= and/or 3= UTR of HCV RNA and regulate translation and/or replication (14)(15)(16)(17)(18)(19)(20).…”

mentioning

confidence: 99%

Sam68 Promotes Hepatitis C Virus Replication by Interaction with Stem-Loop 2 of Viral 5′ Untranslated Region

Qin

Xun

Guo

et al. 2019

J Virol

View full text Add to dashboard Cite

The Src-associated in mitosis 68-kDa (Sam68) protein is a highly conserved nuclear protein and is involved in a series of cellular processes, including transcription and signal transduction. Sam68 is comprised of 443 amino acids and contains an RGG box domain, a KH domain, and a tyrosine-rich domain. Its role in hepatitis C virus (HCV) replication is unknown. Here, we find that Sam68 promotes HCV replication without affecting viral translation. The RNA immunoprecipitation experiments show that the positive strand of HCV RNA interacts with Sam68. HCV infection triggers the translocation of the Sam68 protein from the nucleus to the cytoplasm, where it interacts with the HCV genome. Further study shows that the region of Sam68 spanning amino acids 1 to 157 is the pivotal domain to interact with the stem-loop 2 of the HCV 5= untranslated region (5= UTR) and is responsible for the enhancement of HCV replication. These data suggested that Sam68 may serve as a proviral factor of HCV to facilitate viral replication through interaction with the viral genome. IMPORTANCE Hepatitis C virus (HCV) is a member of the Flaviviridae family, and its infection causes chronic hepatitis, liver cirrhosis, and even hepatocellular carcinoma. No vaccine is available. Many host factors may be implicated in the pathogenesis of HCV-related diseases. This study discloses a new host factor that binds to the HCV 5= UTR and promotes HCV replication. Sam68 may play an important role in HCVrelated diseases, and further investigation is highly encouraged to explore its specific actions in HCV pathogenesis. FIG 4 Sam68 directly binds to HCV RNA. (A and B) Huh7.5 cells were infected with HCV at an MOI of 0.1 for 72 h. The cells were harvested and immunoprecipitated with control IgG or anti-Sam68 antibody or anti-PCBP2 antibody. (A) RNA was extracted from the precipitate complex and subjected to RT-PCR or qRT-PCR analysis. (B) Protein from the precipitate complex was detected by immunoblotting with the anti-Sam68 and PCBP2 antibodies. (C) Purified Sam68 protein (0.5 g) and in vitro transcribed JFH1 RNA (1 g) were incubated in binding buffer for 20 min at room temperature followed by RIP analysis. (D) Gel shift analysis of complex formation between 30 pmol of purified Sam68 protein and 10 pmol of in vitro transcribed JFH1 RNA. Arrows denote the positions of unbound RNA and RNA-Sam68 complexes. Qin et al.TABLE 3 Primers used for amplification of HCV genome fragments Fragment (size [bp]) Primer sequence (5=-3=) 3= UTR (236) CGGAATTCAGCGGCACACACTAGGTACA (forward, 9443-9462) GCTCTAGAACATGATCTGCAGAGAGACC (reverse, 9678-9659) 5= UTR (340) CGGAATTCACCTGCCCCTAATAGGGGCG (forward, 1-20) GCTCTAGAGGTGCACGGTCTACGAGACC (reverse, 340-321) SL1-3 (296) CGGAATTCACCTGCCCCTAATAGGGGCG (forward, 1-20) GCTCTAGAATCAGGCAGTACCACAAGGC (reverse, 296-277) SL2-4 (301) CGGAATTCCCCCTGTGAGGAACTACTGT (forward, 40-59) GCTCTAGAGGTGCACGGTCTACGAGACC (reverse, 340-321) SL3-4 (241) CGGAATTCGTCGTACAGCCTCCAGGCCC (forward, 100-119) GCTCTAGAGGTGCACGGTCTACGAGACC (reverse, 340-321) Qin et al.

show abstract

RNA binding protein 24 regulates the translation and replication of hepatitis C virus

Cited by 21 publications

References 62 publications

RBM24 stabilizes hepatitis B virus pregenomic RNA but inhibits core protein translation by targeting the terminal redundancy sequence

RBM24 stabilizes hepatitis B virus pregenomic RNA but inhibits core protein translation by targeting the terminal redundancy sequence

Hepatitis C Virus Translation Regulation

Sam68 Promotes Hepatitis C Virus Replication by Interaction with Stem-Loop 2 of Viral 5′ Untranslated Region

Contact Info

Product

Resources

About