RNA affinity tags for purification of RNAs and ribonucleoprotein complexes

Abstract

Intrinsic affinity tags are useful tools for the study of macromolecular targets. Although polypeptide affinity tags are routinely used in purification and detection of protein complexes, there has been a relative lack of powerful RNA affinity tags that can be embedded within RNA sequences. Here, the preparation and use of two RNA affinity tags against Sephadex or streptavidin are described. The two tags have different strengths that make them appropriate for slightly different uses. One is a high-affinity ligand for streptavidin that can be specifically eluted by competition with biotin under otherwise native binding conditions. The other tag binds selectively to Sephadex beads, and can be eluted by competition with the soluble dextran that composes Sephadex. When properly placed within another RNA molecule, the tags can be used to effect dramatic purification of RNA or ribonucleoprotein complexes from complex mixtures of cellular RNA.

Genome-wide search for yeast RNase P substrates reveals role in maturation of intron-encoded box C/D small nucleolar RNAs

“…Identifying RNAs That Copurify with RNase P. Potential RNase P substrates were determined by identifying RNAs that copurify with RNase P. RNase P was purified by using either a small RNA affinity tag (aptamer) in the RNA subunit (Rpr1r) that binds to streptavidin (29,30) or a TAP tag (31) on the protein subunit that is unique to RNase P, Rpr2p. Untagged wild-type RNase P was subjected to the same purification steps to establish a background for RNA contaminants in the purification process.…”

“…Affinity purification. In a yeast strain containing a C-terminal tandem affinity purification (TAP) tag on RPR2 (Open Biosystems; YSC1178-7501110), chromosomal RPR1 was disrupted with HIS3 and replaced with a plasmid, pRS315, containing RPR1 with RNA affinity tags for streptavidin and Sephadex (29,30). Temperature-sensitive mutations.…”

Characterization of proteins associating with 5’ terminus of PGHS-1 mRNA

“…A construct containing a random GAPDH gene sequence (lacking AUG or STOP codons) was prepared by introducing a SacII restriction site into the pLuc135 construct using the Quick Change® Site Directed Mutagenesis kit (Stratagene) to allow for the insertion of a random 100 nucleotide long GAPDH sequence, two nucleotides downstream from the AUG start codon of PGHS-1. DNA template for in vitro transcription were generated by linearizing pLuc135 and pLuc135GAPDH constructs with NheI and XhoI restriction enzymes and adding an S1-tag [21,22] template up-stream of the PGHS-1 5'UTR sequence by using forward (GGAATTCTAATACGACTCACTATAGGGACCGACCAGAATCATG CAAGTGCGTAAGATAGTCGCGGGCCGGGCTGCACTCTGCGTCCCGCAC) and reverse (TTCACTGGCGTGGGCGCCCCTGG) primers and Platinum DNA Taq polymerase (Invitrogen) in a PCR reaction. PCR conditions were the following: 1 cycle of 94°C for 2 min; 40 cycles of 94°C for 30 s, 50°C 30 s and 72°C 1 min; using an automated thermal cycler (Mastercycle® personal; Eppendorf).…”

“…A downside of formaldehyde use is that it leads to the formation of multi-molecular bridges, creating artifacts of macromolecules that are pulled down as a single complex and limit the identification of direct and indirect protein-RNA interaction [20]. To overcome problems associated with traditional affinity purification methods, we employed a newly reported protocol of RNA affinity tag purification [21][22][23] facilitating the detection of ribonucleoprotein complexes interacting with the 5' end of PGHS-1 mRNA sequence, which was previously shown to have an impact on the translational efficiency. The advantage of the S1 affinity tag protocol is the use of small RNA which serves as an affinity tag that binds with high affinity and specificity to streptavidin affinity resins even in high salt concentrations.…”

“…The advantage of the S1 affinity tag protocol is the use of small RNA which serves as an affinity tag that binds with high affinity and specificity to streptavidin affinity resins even in high salt concentrations. Ribonucleoprotein complexes can be eluted under mild, native conditions allowing the retention of an intact complex structure [21,22]. Therefore, in the current study, we set to investigate the composition of protein complexes associating with the 5'end of PGHS-1 mRNA using S1 tag protocol.…”