Reverse transcription of trypanosome variable antigen mRNAs initiated by a specific oligonucleotide primer.

Abstract

African trypanosomes change their antigenicity by successively expressing different members of a group of related but highly diverse proteins, the variant surface glycoproteins (VSGs). We describe a synthetic oligonucleotide that can prime specifically reverse transcription of VSG mRNA out of total trypanosome poly(A)+RNA. The specificity of this priming was verified by cDNA sequence analysis of the transcription products and by the demonstration of variant-specific hybridization of the individual cDNAs to cellular RNA. The oligonucleotide primer also was used as a probe for the conserved sequence found on these VSG mRNAs in trypanosome genomic DNA libraries. A large number of primer-positive clones were detected in a Trypanosoma gambiense genomic library, but very few positive signals were found in a library of Trypanosoma congolense genomic DNA.The parasitic hemoprotozoan Trypanosoma brucei gambiense and related trypanosomes cause potentially fatal disease in both man and domestic animals. The course of infection in most vertebrate hosts is marked by a series of peaks of parasitemia, during which antigenically distinct populations of trypanosomes rise to predominance in the bloodstream. This widespread antigenic variation allows at least a segment of the parasite population to escape the host immune response and, in so doing, accounts for the relapsing nature of the infection (1).There is now a strong body of evidence which suggests that this variation is mediated by the successive expression of genes for different variants of the major surface protein, the variant surface glycoprotein (VSG) (2-4). Studies of unicellular infections indicate that this capacity for antigenic variation exists within individual cells (5), but the mechanism responsible for this selective transcription of one VSG gene at a time remains unclear (reviewed in ref. 6).One particular aspect of the phenomenon of antigenic variation further complicates the immunological and molecular analysis of this process. Although certain VSG serotypes can be shown to predominate early in an infection (7,8), a precise order in the expression of different VSGs is not detectable. Accordingly, one cannot predict which antigenic type will succeed a switch in VSG gene expression, and, because the resulting variant antigen type may express any one of >100 different VSGs (9, 10), the switch in antigen expression can only be detected indirectly by the loss of the preceding antigen.Recent DNA sequence determinations of cDNA clones derived from different VSG mRNAs have revealed a common feature of VSG mRNA structure that is present regardless of the VSG for which the mRNAs code (11)(12)(13)(14). A sequence of 16 nucleotides within the 3' noncoding region of the mRNA adjacent to the addition site for the poly(A) tail is apparently invariant (Fig. 1). We have attempted to exploit this region of homology to develop a means for detecting VSG-specific mRNAs without regard to the coding specificity of the molecules and without the necessity for antigen purifi...

Calmodulin genes in trypanosomes are tandemly repeated and produce multiple mRNAs with a common 5' leader sequence.

“…T. b. gambiense cloned variant antigen types of the Texas trypanozoon antigen type (TXTat) serodeme were used (5). Bloodstream trypanosomes were grown in irradiated rats and purified by chromatography on DEAEcellulose (6).…”

“…High molecular weight trypanosome DNA and total cytoplasmic RNA was isolated as described (5). Poly(A)+ RNA was prepared by three passages through an oligo(dT)-cellulose column.…”

Active late-appearing variable surface antigen genes in Trypanosoma equiperdum are constructed entirely from pseudogenes.

“…There are two highly conserved sequences, referred to as the 8-mer and the 14-mer, located at the 3' ends of all complete VSG genes (18)(19)(20). As shown in Fig.…”

Biological Variation Among African Trypanosomes: I. Clonal Expression of Virulence Is Not Linked to the Variant Surface Glycoprotein or the Variant Surface Glycoprotein Gene Telomeric Expression Site

“…Polyadenylated RNA was isolated from frozen trypanosome pellets by conventional procedures of polytron homogenization in 8 M guanidinium hydrochloric acid (HCl), centrifugation through 5.7 M CsCl cushions, and poly(Aþ) RNA selection on oligo dT columns. RNA was reverse transcribed using 200 units moloney murine leukemia virus (M-MLV) reverse transcriptase and a 28-bp oligonucleotide primer based on a 3 0 conserved sequence present in all VSG transcripts (Merritt et al, 1983) (GGGTAACTTACGTGTTAAAA TATATCAG). The following reaction conditions were used: 10 mg polyA RNA, 0.5 mg 28mer, 500 mM dNTPs, 2 mg BSA, 40 units RNAsin, 1 mg actinomycin D, and 0.4 mg globin RNA in 10 mM Tris [pH 8.3], 0.15 mM KCl, 0.10 mM DTT, and 3 mM MgCl 2 .…”