Retinoic acid‐induced CD38 expression in HL‐60 myeloblastic leukemia cells regulates cell differentiation or viability depending on expression levels

Lamkin, Thomas J.; Chin, Vivian; Varvayanis, Susi; Smith, James L.; Sramkoski, R. Michael; Jacobberger, James W.; Yen, Andrew

doi:10.1002/jcb.20745

Cited by 39 publications

(56 citation statements)

References 38 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…CD38 mediates the production of proinflammatory cytokines, proliferation, and protection from apoptosis in lymphocytes (42)(43)(44). Lamkin et al (45) showed that RA induces the early expression of CD38, which signals through MAPK to promote RAinduced cell differentiation. The WT c-Cbl and mutant G306E and C381A stable transfectants all had comparable, enhanced RA-induced CD38 expression compared with vector controls.…”

Section: Discussionmentioning

confidence: 99%

c-Cbl Tyrosine Kinase-binding Domain Mutant G306E Abolishes the Interaction of c-Cbl with CD38 and Fails to Promote Retinoic Acid-induced Cell Differentiation and G0 Arrest

Shen

Yen

2009

Journal of Biological Chemistry

Self Cite

View full text Add to dashboard Cite

Retinoic acid (RA) causes HL-60 human myeloblastic leukemia cell myeloid differentiation that is dependent on MAPK signaling. The process is propelled by c-Cbl, which binds the CD38 receptor as part of a signaling complex generating MAPK signaling. Here we report that the capability of c-Cbl to do this is lost in the G306E tyrosine kinase-binding domain mutant. Retinoic acid (RA), 2 a form of vitamin A, can cause activation of MAPK signaling leading to induced cell differentiation and G 0 cell cycle arrest (1-2). Because of this, RA has been used therapeutically for the chemoprevention and treatment of cancer (3), notably acute promyelocytic leukemia, making its mechanism of action of significant interest. The HL-60 human myeloblastic leukemia cell line serves as a model for studying differentiation induction therapy and the mechanism of RA action (4 -6). The HL-60 cell line was established from peripheral blood leukocytes of a patient originally diagnosed with acute promyelocytic leukemia (4), which was retrospectively re-evaluated to be acute myeloblastic leukemia (7). HL-60 cells undergo G 0 cell cycle arrest and myeloid differentiation in response to RA or monocytic differentiation in response to 1,25-dihydroxyvitamin D 3 . Induced differentiation depends on hyperactive MAPK signaling (1, 8). c-Cbl contributes propulsion to this process (9, 10). It is part of a signaling complex connected to the CD38 receptor that activates the RAF/MEK/ ERK MAPK signaling axis to drive differentiation and G 0 cell cycle arrest (9).The 120-kDa product of the c-Cbl protooncogene is a prominent component of tyrosine kinase signaling cascades downstream of activated cell surface receptors, including the epidermal growth factor receptor, the B cell receptor, Fc receptor, and cytokine receptors (11,12). Cbl proteins have a highly conserved N-terminal domain termed the tyrosine kinase-binding (TKB) domain, which binds to phosphotyrosines on activated receptor-tyrosine kinases and other signaling proteins (13, 14), a short linker region, and a Ring finger domain that binds to ubiquitin-conjugating enzymes (15, 16). The Ring finger domain of c-Cbl presents the most conserved region among Cbl family proteins, and it is implicated as an important element in the function of Cbl proteins (17)(18)(19). The TKB domain contains a four-helix bundle, EF-hand calcium-binding domain, and a variant SH2 domain that binds to phosphotyrosine residues (13,20). Several features of the Cbl/Zap-70 complex (13) suggest that the four-helix bundle, EF-hand, and SH2 domains together form an interactive structure that is crucial for phosphoprotein recognition. Studies by Thien et al. (21) indicated that the TKB mutation, G306E, fails to bind phosphotyrosine residues and is a loss of function mutation in the c-Cbl TKB domain.Cbl interacts with a number of intracellular signaling molecules including various receptors, adaptors, cytoskeletal proteins, ubiquitin, and structural proteins via its various domains (22,23). One of the receptors is CD38. The human c...

show abstract

Section: Discussionmentioning

confidence: 99%

c-Cbl Tyrosine Kinase-binding Domain Mutant G306E Abolishes the Interaction of c-Cbl with CD38 and Fails to Promote Retinoic Acid-induced Cell Differentiation and G0 Arrest

Shen

Yen

2009

Journal of Biological Chemistry

Self Cite

View full text Add to dashboard Cite

show abstract

“…Generation of Stable Transfectants-1) BLR1 stable transfectants were generated using a modified pIRES-EGFP expression vector, namely the plasmid pEF-IRES2-EGFP (pEIE) (13,14). The open reading frame of BLR1 was isolated by RT-PCR and cloned into the EcoRI site of pCR-BluntII-TOPO vector (Invitrogen) with a pair of primers as follows: forward primer, 5ЈGGAATTCATGAACTACCCGCTAACGC3Ј, and reverse primer, 5ЈGAATTCTAGAACGTGGTGAG3Ј.…”

Section: Methodsmentioning

confidence: 99%

A MAPK-positive Feedback Mechanism for BLR1 Signaling Propels Retinoic Acid-triggered Differentiation and Cell Cycle Arrest

Wang

Yen

2008

Journal of Biological Chemistry

Self Cite

106

View full text Add to dashboard Cite

show abstract

“…To answer this question, we induced differentiation of HL60 cells with three other well established differentiation agents and ceramide, a stress inducing agent that has also been reported to induce monocytic differentiation (Rovera et al, 1979;Bunce et al, 1983;Bielawska et al, 1992;Lamkin et al, 2006). As shown in Figure 1, exposure of HL60 cells to concentrations of these compounds reported to induce differentiation (Rovera et al, 1979;Bunce et al, 1983;Bielawska et al, 1992;Lamkin et al, 2006) failed to significantly upregulate KSR-1 expression, while 1,25D did produce the expected upregulation. This suggests that there may be a special link between 1,25D signaling and KSR-1 gene expression.…”

Section: Ksr-1 Expression Is Selectively Upregulated By 125d In Diffmentioning

confidence: 95%

Induction of kinase suppressor of RAS-1(KSR-1) gene by 1, α25-dihydroxyvitamin D3 in human leukemia HL60 cells through a vitamin D response element in the 5′-flanking region

Wang

White

et al. 2006

Oncogene

View full text Add to dashboard Cite

Differentiation therapy is being developed as an additional therapeutic option for the treatment of several forms of cancer, including myeloid leukemia. In model systems, the physiologically active form of vitamin D, 1, a25-dihydroxyvitamin D 3 (1,25D), induces monocytic differentiation of human myeloid cells, but the mechanism is not clear. We report here, the first direct connection between the signal provided by 1,25D and the molecular circuitry known to be involved in monocytic differentiation. Specifically, we show that 1,25D selectively increases the expression of the gene encoding kinase suppressor of Ras-1 (KSR-1) in HL60 cells, while other differentiationinducing agents such as 12-O-tetradecanoylphorbol-13-acetate, retinoic acid or dimethyl sulfoxide do not significantly increase KSR-1 expression. Further, the upregulation of KSR-1 gene by 1,25D is competed by ZK159222, an antagonist of vitamin D receptor (VDR) action, and can occur in the presence of protein synthesis inhibitor cycloheximide, showing that the effect is direct. Most importantly, we have identified a vitamin D responsive element (VDRE) in the promoter region of the human KSR-1 gene, to which VDR binds in a 1,25D-dependent manner, in vitro and in vivo. This binding is paralleled by increased association of RNA polymerase II with the transcription start site of KSR-1 gene, and the VDRE is functional in reporter assays. Our findings offer a potential mechanism for a signaling pathway that contributes to 1,25D-induced monocytic differentiation of human myeloid leukemia cells.

show abstract

Retinoic acid‐induced CD38 expression in HL‐60 myeloblastic leukemia cells regulates cell differentiation or viability depending on expression levels

Cited by 39 publications

References 38 publications

c-Cbl Tyrosine Kinase-binding Domain Mutant G306E Abolishes the Interaction of c-Cbl with CD38 and Fails to Promote Retinoic Acid-induced Cell Differentiation and G0 Arrest

c-Cbl Tyrosine Kinase-binding Domain Mutant G306E Abolishes the Interaction of c-Cbl with CD38 and Fails to Promote Retinoic Acid-induced Cell Differentiation and G0 Arrest

A MAPK-positive Feedback Mechanism for BLR1 Signaling Propels Retinoic Acid-triggered Differentiation and Cell Cycle Arrest

Induction of kinase suppressor of RAS-1(KSR-1) gene by 1, α25-dihydroxyvitamin D3 in human leukemia HL60 cells through a vitamin D response element in the 5′-flanking region

Contact Info

Product

Resources

About