Resistance to human respiratory syncytial virus (RSV) infection induced by immunization of cotton rats with a recombinant vaccinia virus expressing the RSV G glycoprotein.

Abstract

A cDNA copy of the G glycoprotein gene of human respiratory syncytial virus (RSV) was placed under control of a vaccinia virus promoter and inserted into the thymidine kinase locus of the vaccinia virus genome. The recombinant vaccinia virus retained infectivity and expressed a 93-kDa protein that migrated with the authentic RSV G glycoprotein upon polyacrylamide gel electrophoresis. Glycosylation of the expressed protein and transport to the cell surface were demonstrated in the absence of other RSV proteins. Cotton rats that were inoculated intradermally with the infectious recombinant virus produced serum antibody to the G glycoprotein that neutralized RSV in vitro. Furthermore, the vaccinated animals were resistant to lower respiratory tract infection upon intranasal inoculation with RSV and had reduced titers of RSV in the nose, (4,5). The larger one, designated G, has a molecular mass of about 90 kDa and is thought to be needed for virus adsorption. The smaller one, designated F because of its probable role in membrane fusion (6), consists of a 70-kDa protein that is proteolytically processed into 8). Passive immunization of cotton rats (9) and mice (10) with monoclonal antibodies to either glycoprotein provides protection against lower respiratory tract infection with RSV. Additional studies to delineate the roles of the glycoproteins in protective immunization have been hampered by the difficulty in obtaining sufficient amounts of purified materials. The recent cloning of cDNA copies of the mRNAs for both glycoproteins (11_14), however, opens the possibility of using expression vectors to produce the 90-and 70-kDa proteins.Vaccinia virus provides a novel eukaryotic vector system (15, 16) that should be particularly suitable for studies with RSV. Surface antigen genes from a variety of have been expressed by recombinant vaccinia viruses. When properly engineered, the proteins were synthesized, processed, and transported to the plasma membrane. In most cases, experimental animals were shown to produce neutralizing antibodies and were protected against a challenge with the corresponding virus. Evidence for priming of a cytotoxic T-cell response also has been obtained with recombinant vaccinia viruses that express influenza virus genes (25,26). We now describe a recombinant vaccinia virus that expresses the RSV G glycoprotein and protectively immunizes cotton rats against lower respiratory tract infection with RSV. MATERIALS AND METHODSViruses and Cells. Vaccinia virus (WR strain) was grown in HeLa (human) cells and purified from cytoplasmic extracts by sucrose gradient centrifugation. RSV (strain A2) was propagated on HEp-2 (human) cell monolayers.Isolation of DNA. DNA was isolated from purified vaccinia virus as described (27). Plasmid DNA was prepared by using a modified alkaline sodium dodecyl sulfate (NaDodSO4) procedure (28). Lysozyme was omitted from the lysis step and the DNA was purified from RNA by passage through a Sepharose-4B column. DNA fragments were' purified from agarose gels by e...

Transport to the cell surface of a peptide sequence attached to the truncated C terminus of an N-terminally anchored integral membrane protein.

“…The corresponding three recombinant vaccinia viruses containing truncated RSVG genes but without NANP sequences were constructed as controls and called VG2, VG3, and VG4. RSVG is heavily glycosylated, and roughly 60% of the apparent molecular weight of this protein is believed to be contributed by the carbohydrate moieties (11,28). To detect and characterize the hybrid proteins expressed by the recombinant viruses, extracts of CV-1 cells infected with each of the three recombinant viruses, as well as control wild-type virus-infected and uninfected cells, were electrophoresed in 10% polyacrylamide gels.…”

“…The complete gene for RSVG, present as a BamHI fragment in M13mp18 (11), was mutagenized at proline residues 71, 180, and 230 by using the oligonucleotides d(AAGTCACACCCGGGTAAGGATCCA CAACTGCAA), d(GCAACAATCCCGGGTAAGGATCCA CCTGCTGGGC), and d(CCACCAAGCCCGGGTAAGG AT), respectively. Mutagenesis introduced a SmaI site, followed by a termination codon in frame with the RSVGcoding sequence and a BamHI site, after each of the prolines mentioned previously.…”

Helper T Cell Recognition of Respiratory Syncytial Virus in Mice

“…The protective immunity induced by VV recombinants encoding the RSV F and G proteins has been described both in mice Stott et al, 1986) and cotton rats (Olmsted et al, 1986;Elango et al, 1986). The studies in mice showed that infection with 107 p.f.u, ofF or G VV intraperitoneally protected mice from intranasal infection with natural RSV 3 weeks after priming.…”

Expression of the Infectious Bronchitis Virus Spike Protein by Recombinant Vaccinia Virus and Induction of Neutralizing Antibodies in Vaccinated Mice

“…Additionally, other eukaryotic viral glycoproteins have been correctly glycosylated and transported within recombinant vaccinia virus-infected cells (for review, see Mackett & Smith, 1986). The infectivity of recombinant vaccinia viruses has enabled animals to be vaccinated and protected against subsequent challenge with influenza virus (Smith et al, 1983b), herpes simplex virus (Paoletti et al, 1984;Cremer et al, 1985), hepatitis B virus , rabies virus Wiktor et al, 1984), vesicular stomatitis virus and human respiratory syncytial virus (Ball et al, 1986;Elango et al, 1986). This protection may be attributable to the ability of the recombinant viruses to induce both antibody and cytotoxic T cell responses specific for the foreign gene product (Bennink et al, 1984Wiktor et al, 1984;Yewdell et al, 1985).…”