Requirement of activating transcription factor 5 for murine fetal liver erythropoiesis

Zhang, Shuping; Chen, Jane-Jane

doi:10.1111/bjh.16202

Cited by 7 publications

(4 citation statements)

References 13 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The ΔΔC(t) method was used to quantify the fold change of the target genes. The primer sets used were: ATF4 (Forward, GCCGGTTTAAGTTGTGTGCT; Reverse, CTGGATTCGAGGAATGTGCT) (67), ATF5 (Forward, GGGTCATTTTAGCTCTGTGAGAGAA; Reverse, ATTTGTGCCCATAACCCCTAGA) (68), and RPS20 (Forward, AACAAGTCGGTCAGGAAGC; Reverse, TCCGCACAAACCTTCTCC).…”

Section: Methodsmentioning

confidence: 99%

Mitochondrial energy dysfunction induces remodeling of the cardiac mitochondrial protein acylome

Ghazal

et al. 2021

Preprint

View full text Add to dashboard Cite

Mitochondria are increasingly recognized as signaling organelles because, under conditions of stress, mitochondria can trigger various signaling pathways to coordinate the cell’s response. The specific pathway(s) engaged by mitochondria in response to defects in mitochondrial energy production in vivo and in high-energy tissues like the heart are not fully understood. Here, we investigated cardiac pathways activated in response to mitochondrial energy dysfunction by studying mice with cardiomyocyte-specific loss of the mitochondrial phosphate carrier (SLC25A3), an established model that develops cardiomyopathy as a result of defective mitochondrial ATP synthesis. In heart tissue from these mice, mitochondrial energy dysfunction induced a striking pattern of acylome remodeling, with significantly increased post-translational acetylation and malonylation. Mass spectrometry-based proteomics further revealed that energy dysfunction-induced remodeling of the acetylome and malonylome preferentially impacts mitochondrial proteins. Acetylation and malonylation modified a highly interconnected interactome of mitochondrial proteins, and both modifications were present on the enzyme isocitrate dehydrogenase 2 (IDH2). Intriguingly, IDH2 activity was enhanced in SLC25A3-deleted mitochondria, and further study of IDH2 sites targeted by both acetylation and malonylation revealed that these modifications can have site-specific and distinct functional effects. Finally, we uncovered a novel crosstalk between the two modifications, whereby mitochondrial energy dysfunction-induced acetylation of sirtuin 5 (SIRT5), inhibited its function. Because SIRT5 is a mitochondrial deacylase with demalonylase activity, this finding suggests that acetylation can modulate the malonylome. Together, our results position acylations as an arm of the mitochondrial response to energy dysfunction and suggest a mechanism by which focal disruption to the mitochondrial energy production machinery can have an expanded impact on global mitochondrial function.

show abstract

Section: Methodsmentioning

confidence: 99%

Mitochondrial energy dysfunction induces remodeling of the cardiac mitochondrial protein acylome

Ghazal

et al. 2021

Preprint

View full text Add to dashboard Cite

show abstract

“…A recent study revealed that ATF5 is enriched in odontoblast-related nucleosome-free regions and promotes odontoblast terminal differentiation by increasing the enhancer activity of dentin matrix protein 1 (DMP1), which is mainly expressed in the odontoblast layer and important for bone development [36]. Another study demonstrated that the knockdown of ATF5 in murine erythroid progenitor cells significantly reduced the proliferation of fetal liver erythroid progenitors and inhibited erythroid differentiation [37].…”

Section: Cell Differentiation and Tissue Developmentmentioning

confidence: 99%

Advancements in Activating Transcription Factor 5 Function in Regulating Cell Stress and Survival

Paerhati

Liu

Jin

et al. 2022

IJMS

View full text Add to dashboard Cite

Activating transcription factor 5 (ATF5) belongs to the activating transcription factor/cyclic adenosine monophosphate (cAMP) response element-binding protein family of basic region leucine zipper transcription factors. ATF5 plays an important role in cell stress regulation and is involved in cell differentiation and survival, as well as centrosome maintenance and development. Accumulating evidence demonstrates that ATF5 plays an oncogenic role in cancer by regulating gene expressions involved in tumorigenesis and tumor survival. Recent studies have indicated that ATF5 may also modify the gene expressions involved in other diseases. This review explores in detail the regulation of ATF5 expression and signaling pathways and elucidates the role of ATF5 in cancer biology. Furthermore, an overview of putative therapeutic strategies that can be used for restoring aberrant ATF5 activity in different cancer types is provided.

show abstract

“…They are involved in serine-glycine biosynthesis, one carbon metabolism, proline-glutamine synthesis and glutathione metabolism. Expression of these genes by HRI-ATF4 signaling are necessary to mitigate oxidative stress and to promote erythroid differentiation [17 ▪▪ ,39 ▪▪ ].…”

Section: Introductionmentioning

confidence: 99%

Translational control by heme-regulated elF2α kinase during erythropoiesis

Chen

Zhang

2022

Current Opinion in Hematology

Self Cite

View full text Add to dashboard Cite

Purpose of reviewHRI is the heme-regulated elF2α kinase that phosphorylates the α-subunit of elF2. Although the role of HRI in inhibiting globin synthesis in erythroid cells is well established, broader roles of HRI in translation have been uncovered recently. This review is to summarize the new discoveries of HRI in stress erythropoiesis and in fetal γ-globin expression.Recent findingsHRI and activating transcription factor 4 (ATF4) mRNAs are highly expressed in early erythroblasts. Inhibition of protein synthesis by HRI-phosphorylated elF2α (elF2αP) is necessary to maintain protein homeostasis in both the cytoplasm and mitochondria. In addition, HRI-elF2αP specifically enhances translation of ATF4 mRNA leading to the repression of mechanistic target of rapamycin complex 1 (mTORC1) signaling. ATF4-target genes are most highly activated during iron deficiency to maintain mitochondrial function, redox homeostasis, and to enable erythroid differentiation. HRI is therefore a master translation regulator of erythropoiesis sensing intracellular heme concentrations and oxidative stress for effective erythropoiesis. Intriguingly, HRI-elF2αP-ATF4 signaling also inhibits fetal hemoglobin production in human erythroid cells.SummaryThe primary function of HRI is to maintain protein homeostasis accompanied by the induction of ATF4 to mitigate stress. Role of HRI-ATF4 in γ-globin expression raises the potential of HRI as a therapeutic target for hemoglobinopathy.

show abstract

Requirement of activating transcription factor 5 for murine fetal liver erythropoiesis

Cited by 7 publications

References 13 publications

Mitochondrial energy dysfunction induces remodeling of the cardiac mitochondrial protein acylome

Mitochondrial energy dysfunction induces remodeling of the cardiac mitochondrial protein acylome

Advancements in Activating Transcription Factor 5 Function in Regulating Cell Stress and Survival

Translational control by heme-regulated elF2α kinase during erythropoiesis

Contact Info

Product

Resources

About