Reproductive and cytogenetic characterization in Passiflora sublanceolata

Belo, G O; Souza, Margarete Magalhães; Souza, Viviane O. de; Melo, Cláusio Antônio Ferreira de

doi:10.1515/biolog-2015-0089

Cited by 11 publications

(6 citation statements)

References 38 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…2001; Melo & Guerra 2003; Belo et al . 2015). Likewise, the position of P. foetida , based on molecular phylogeny, has always been problematic within the subgenus Passiflora (Muschner et al .…”

Section: Discussionmentioning

confidence: 99%

Origin of the cultivated passion fruit Passiflora edulis f. flavicarpa and genomic relationships among species of the subgenera Decaloba and Passiflora

Silva

Souza

2020

Plant Biol J

View full text Add to dashboard Cite

Passiflora edulis f. flavicarpa is the most economically important species in the genus Passiflora. However, the origin of this yellow form of passion fruit remains unclear, being suggested as a hybrid (P. edulis f. edulis × P. ligularis) or wild mutant. Here, the origin and genomic relationships of P. edulis f. flavicarpa with some related species in the genus Passiflora (subgenera Decaloba and Passiflora) were investigated using genomic in situ hybridization (GISH). Genomic DNA of 18 species was used as probe, which was hybridized onto chromosomes of P. edulis f. flavicarpa. Of all genomic DNA probes tested, none allowed us to identify a specific chromosome set in P. edulis f. flavicarpa. Conversely, probes from the subgenus Passiflora, P. edulis f. edulis, P. alata, P. cincinnata, P. coccinea, P. nitida and P. vitifolia, produced intense and uniform hybridizations on all chromosomes of P. edulis f. flavicarpa. Moreover, probes from P. ligularis, P. foetida and P. sublanceolata produced more intense hybridizations in the terminal region of four chromosomes, corresponding to the DNAr 45S locus, and also dispersed, less intense, hybridization across all chromosomes. Probes from the subgenus Decaloba, P. biflora, P. capsularis, P. cervii, P. coriacea, P. micropetala, P. morifolia, P. rubra and P. suberosa, produced hybridizations restricted to the DNAr 45S sites. The hybrid origin of P. edulis f. flavicarpa could not be supported based on the GISH results, and it is suggested that this species is conspecific with P. edulis f. edulis, because the probe with DNA of this form hybridized strongly throughout the target genome. The other putative parent species, P. ligularis, showed only a distant relationship with the target genome. The results also suggest that species of the subgenus Passiflora share many repetitive sequences and that the relationship between subgenera Decaloba and Passiflora is very distant.

show abstract

Section: Discussionmentioning

confidence: 99%

Origin of the cultivated passion fruit Passiflora edulis f. flavicarpa and genomic relationships among species of the subgenera Decaloba and Passiflora

Silva

Souza

2020

Plant Biol J

View full text Add to dashboard Cite

show abstract

“…The presence of CMA3 + blocks in the terminal region of some chromosomes is generally related to the nucleolar organizing regions (NORs) observed in angiosperms (Guerra, 2000). In species of the genus Passiflora, GC-rich regions detected by fluorochrome CMA3 are observed only in 45S rDNA/satellite DNA sites (Melo et al, 2001;Viana & Souza, 2012;Melo et al, 2014;Belo et al, 2015). The distribution of satellite DNA/45S rDNA regarding CMA3 was analyzed in some species of the genus Citrus, and both probes hybridized only with CMA3 and the centromeres (Silva et al, 2010).…”

Section: Discussionmentioning

confidence: 99%

Karyotypic characterization of melon accessions

Santos-Sanchês¹,

Souza²,

Melo³

et al. 2019

Científica

View full text Add to dashboard Cite

Cucumis melo (melon) is a species from the Iberian Peninsula and is included in the family Cucurbitaceae. Despite the knowledge about the physical structure of melon chromosomes, little is known about the intraspecific karyotype diversity of the species. To study karyotype diversity in eight melon accessions, the following methods were used: Giemsa 3% staining; application of CMA3/DAPI fluorochromes; and location of 45S and 5S rDNA sequences by fluorescence in situ hybridization. Conventional staining analysis revealed stability in the chromosome number, with accessions presenting 2n = 24. There were significant variations in the mean chromosome size between accessions, ranging from 0.98 μm to 1.46 μm for accessions A26 and A18, respectively. Scott-Knott clustering distributed the accessions into two groups. GC-rich heterochromatic blocks (CMA3 + /DAPI-) were observed in pericentromeric regions of all chromosomes in the complement. CMA3 + /DAPIblocks were also located in terminal regions, being specific to satellite regions. Hybridization sites of 45S rDNA probes revealed the presence of a chromosome pair with this locus. In addition, 5S rDNA sites revealed a labeled chromosome pair. No quantitative variation was observed in rDNA sites between the accessions analyzed, indicating these markers as ideal for the verification of karyotypic stability in C. melo.

show abstract

“…; Belo et al . ). However, a few exceptions can be seen, such as P. tricuspis with one additional GC‐rich block not related by secondary constriction (Melo et al .…”

Section: Discussionmentioning

confidence: 97%

“…The 5S rDNA and telomere probes were obtained by PCR with the primer pairs 5′‐GTGCGATCATACCAGC(AG)(CT)TAATGCACCGG‐3′ and 5′‐GAGGTGCAACACGAGGACTTCCCAGGAGG‐ 3′ for 5S rDNA (Melo & Guerra ) and 5′‐AAATCCCAAATCCCAAATCCCAAATCCCAAATCCCAAATCCC‐3′ and 5′‐TTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGCGTTTAGG‐3′ for telomere sites (Belo et al . ). Probes constructed for 26S rDNA for the localisation of the 45S rDNA loci were obtained by PCR amplification with primers reported in Silva ().…”

Section: Methodsmentioning

confidence: 97%

Cytogenetics and morphological delimitation between three species of Passiflora L. (subgenus Distephana Cervi)

2019

View full text Add to dashboard Cite

Several studies on cytogenetic characterisation of passion flowers are helpful to elucidate doubts about taxa relationships, delimitation and classification into more coherent groups based on karyomorphological data.• Molecular and conventional cytogenetic techniques were applied to three Passiflora species with red flowers, P. coccinea, P. vitifolia and P. tholozanii, for species karyotype relationships. Additionally, for descriptive morphology, were used flowers, leaves and seeds.• Results describe for the first time the karyomorphological and chromosome number (2n = 18) for P. tholozanii. ANOVA was performed (P < 0.05) and statistical significance for average chromosome size (CV: 16.53%) between species. Genomic in situ hybridisation (GISH) proved relationships between P. coccinea and P. tholozanii, which suggests a common origin, however, we could not identify hybridisation between genomic probes from P. vitifolia in P. tholozanii chromosomes. Among the species analysed, P. tholozanii has great similarity in karyotypic and morphology to P. coccinea but not to P. vitifolia.• We suggest the inclusion of P. tholozanii in the same subgenus and section as P. coccinea based on the similarity in karyomorphological and morphological traits between the species. Additionally, GISH might indicate a common or hybrid origin of P. tholozanii.Plant Biology 21 (2019) 662-669

show abstract

Reproductive and cytogenetic characterization in Passiflora sublanceolata

Cited by 11 publications

References 38 publications

Origin of the cultivated passion fruit Passiflora edulis f. flavicarpa and genomic relationships among species of the subgenera Decaloba and Passiflora

Origin of the cultivated passion fruit Passiflora edulis f. flavicarpa and genomic relationships among species of the subgenera Decaloba and Passiflora

Karyotypic characterization of melon accessions

Cytogenetics and morphological delimitation between three species of Passiflora L. (subgenus Distephana Cervi)

Contact Info

Product

Resources

About