Reovirus Nonstructural Protein σNS Acts as an RNA Stability Factor Promoting Viral Genome Replication

Abstract

Viral nonstructural proteins, which are not packaged into virions, are essential for the replication of most viruses. Reovirus, a nonenveloped, double-stranded RNA (dsRNA) virus, encodes three nonstructural proteins that are required for viral replication and dissemination in the host. The reovirus nonstructural protein σNS is a single-stranded RNA (ssRNA)-binding protein that must be expressed in infected cells for production of viral progeny. However, the activities of σNS during individual steps of the reovirus replication cycle are poorly understood. We explored the function of σNS by disrupting its expression during infection using cells expressing a small interfering RNA (siRNA) targeting the σNS-encoding S3 gene and found that σNS is required for viral genome replication. Using complementary biochemical assays, we determined that σNS forms complexes with viral and nonviral RNAs. We also discovered, using and cell-based RNA degradation experiments, that σNS increases the RNA half-life. Cryo-electron microscopy revealed that σNS and ssRNAs organize into long, filamentous structures. Collectively, our findings indicate that σNS functions as an RNA-binding protein that increases the viral RNA half-life. These results suggest that σNS forms RNA-protein complexes in preparation for genome replication. Following infection, viruses synthesize nonstructural proteins that mediate viral replication and promote dissemination. Viruses from the family encode nonstructural proteins that are required for the formation of progeny viruses. Although nonstructural proteins of different viruses in the family diverge in primary sequence, they are functionally homologous and appear to facilitate conserved mechanisms of dsRNA virus replication. Using and cell culture approaches, we found that the mammalian reovirus nonstructural protein σNS binds and stabilizes viral RNA and is required for genome synthesis. This work contributes new knowledge about basic mechanisms of dsRNA virus replication and provides a foundation for future studies to determine how viruses in the family assort and replicate their genomes.

Function, Architecture, and Biogenesis of Reovirus Replication Neoorganelles

“…These observations suggest that μNS is the viral protein responsible for inclusion nucleation [26]. In turn, the μNS protein recruits viral core proteins and the nonstructural protein σNS, which is a key factor for viral RNA replication [35,36,37]. The μ2 protein, which is a minor constituent of the viral core, defines the morphology of VIs.…”

“…The σNS protein binds and stabilizes the viral RNAs, which might be necessary for sequestering the viral transcripts inside the inclusions. This function of σNS might also protect these RNAs from cytoplasmic nucleases, prevent the activation of innate immune responses, and facilitate viral translation [37]. Additionally, σNS likely recruits the translational machinery to VIs, as σNS co-localizes with eukaryotic translation initiation factor 3 subunit A, ribosomal P protein, phosphorylated ribosomal protein S6, and ribosomal protein S3 in the reovirus inclusions [28].…”

Reovirus σNS and μNS Proteins Remodel the Endoplasmic Reticulum to Build Replication Neo-Organelles

“…Reovirus T1L σNS ( 52 ) and T3D σNS and μNS ( 44 ) expression plasmids have been described elsewhere. T1L μNS expression plasmid was engineered by amplification of the T1L M3 open reading frame to contain 5′ KpnI and 3′ NotI restriction sites using T1L M3 reverse-genetics plasmid pT7-M3T3D ( 49 ) and the following primers: T1L_M3_KpnI5′, CGACGGTACCATGGCTTCATTCAAGGGATTCTCCGTC, and T1L_M3_NotI3′, ATCACAGGCGGCCGCTTACAGCTCATCAGTTGGAACGGAG.…”

“…For single and double immunogold labeling, sections were incubated with primary and secondary antibodies. Primary antibodies were diluted in saturation buffer (1% BSA in PBS) as follows: 1:200 for anti-PDI and anti-calreticulin, 1:50 for anti-dsRNA (English and Scientific Consulting) and anti-BrU (Sigma), 1:100 for rabbit polyclonal λ3-specific antiserum ( 52 ), and 1/200 for the affinity-purified rabbit polyclonal anti-KDEL-R ( 55 ) provided by Irina Majoul (MPI for Biophysical Chemistry, Göttingen, Germany). Grids were incubated at RT for 1 h. Secondary antibodies conjugated with 10- or 15-nm colloidal gold particles were diluted 1:50 in saturation buffer, and samples were incubated at RT for 30 min.…”

Going (Reo)Viral: Factors Promoting Successful Reoviral Oncolytic Infection

“…It is thought that reoviral protein σ3 is responsible for the translational efficiency of the uncapped late viral mRNA, but the mechanism by which σ3 accomplishes this is unknown [ 37 , 107 , 108 ]. Recently it has been shown that σNS also plays a role in RNA binding during viral replication [ 109 ]. Other viruses that impair host translation of capped mRNAs operate by preventing the phosphorylation of the initiation factor 4E-BP1 [ 110 ].…”