Renin expression in developing zebrafish is associated with angiogenesis and requires the Notch pathway and endothelium

Abstract

Rider SA, Mullins LJ, Verdon RF, MacRae CA, Mullins JJ. Renin expression in developing zebrafish is associated with angiogenesis and requires the Notch pathway and endothelium. Am J Physiol Renal Physiol 309: F531-F539, 2015. First published July 22, 2015 doi:10.1152/ajprenal.00247.2015.-Although renin is a critical regulatory enzyme of the cardiovascular system, its roles in organogenesis and the establishment of cardiovascular homeostasis remain unclear. Mammalian renin-expressing cells are widespread in embryonic kidneys but are highly restricted, specialized endocrine cells in adults. With a functional pronephros, embryonic zebrafish are ideal for delineating the developmental functions of renin-expressing cells and the mechanisms governing renin transcription. Larval zebrafish renin expression originates in the mural cells of the juxtaglomerular anterior mesenteric artery and subsequently at extrarenal sites. The role of renin was determined by assessing responses to renin-angiotensin system blockade, salinity variation, and renal perfusion ablation. Renin expression did not respond to renal flow ablation but was modulated by inhibition of angiotensin-converting enzyme and altered salinity. Our data in larval fish are consistent with conservation of renin's physiological functions. Using transgenic renin reporter fish, with mindbomb and cloche mutants, we show that Notch signaling and the endothelium are essential for developmental renin expression. After inhibition of angiogenesis, renin-expressing cells precede angiogenic sprouts. Arising from separate lineages, but relying on mutual interplay with endothelial cells, renin-expressing cells are among the earliest mural cells observed in larval fish, performing both endocrine and paracrine functions. renin; zebrafish; notch; endothelium; angiogenesis RENIN is the rate-limiting enzyme of the renin-angiotensin system (RAS). Mammalian ANG II, the effector of the RAS, is principally involved in blood pressure homeostasis by regulation of vasomotor tone and Na ϩ retention. ANG II also regulates cell proliferation and angiogenesis (12,22). Pathological activation of the RAS is associated with cardiovascular diseases, including hypertension and heart failure, and is consequently a major target of therapeutic agents (11).Renin and its cognate cells are required for normal renal development (2), including angiogenesis of the renal vascular tree (59). In mice, ablation of the renin gene or renin-expressing cells leads to renal developmental abnormalities (55,71,79). The vasculature of mammalian embryonic kidneys have a transient but extensive coverage of mural renin-expressing cells (17,31,32,47,63); however, their function is unclear. Adult renin-expressing cells are restricted to the juxtaglomerular apparatus and play a vital role in ion homeostasis by secreting activated renin enzyme via cytoplasmic granules (17,31,36,63). Upon physiological challenge by RAS inhibition or low Na ϩ , prearteriolar vascular smooth muscle cells (VSMC) reestablish their embryonic re...

Angiotensin II Signal Transduction: An Update on Mechanisms of Physiology and Pathophysiology

“…However, negative data regarding Notch participating in EMT and kidney fibrosis by ANG II have also been reported (548). Notch signaling has also been implicated in development and expression of renin progenitor cells in both zebrafish (868) and mouse (66,128) and was reported to be an important regulator of renin transcription (793).…”

Role of zebrafish ClC‐K/barttin channels in apical kidney chloride reabsorption

“…The oligonucleotide primers used for quantitative PCR (qPCR) were: TCTGGAGGACTGTAAGAGGTATGC (sense) and TCTGGAGGACTGTAAGAGGTATGC (anti‐sense) for Rpl13a (internal control); GCTGTGGCTCGGGCTAAA (sense) and CGGCCAACTTCGGACATG (anti‐sense) for clcnk ; AAACAGGACCTGATTGAAGGAA (sense) and GCCAGCCAAAGGAGCTTT (anti‐sense) for bsnd ; CCTACAGCCCCACGTTGACT (sense) and GGTTTGGAGAGCTGTTGAGTGA (anti‐sense) for clcn2a ; TCTCTTCAAGACGCGCTTCA (sense) and CGATCAGCCTGTTCAGATACACA (anti‐sense) for clcn2b ; ACGTCTTCGTCGTCCTCTTTG (sense) and CAGCACCGATGACGAAAATG (anti‐sense) for clcn2c ; AGACAGTCTTTCTCCACATGCAC (sense) and ACCTGACCCTTGTCCATCATCAG (anti‐sense) for cftr ; AGGCAAGTGGGAGGTCATC (sense) and CCATCCTTGCAAAACAGGAT (anti‐sense) for renin (Rider et al . ); and TCCGAATCGGGATCCATTCAGGTC (sense) and AGTACCGCGGCATCTTATTACCC (anti‐sense) for gucy2c .…”

Zebrafish mesonephric renin cells are functionally conserved and comprise two distinct morphological populations

“…Whole adult fish were fixed in 4% paraformaldehyde (PFA) and processed into paraffin-embedded sagittal sections. In situ hybridization (ISH) was conducted using standard protocols (58,75). Briefly, a 500-bp digoxigenin (DIG)-labeled RNA probe was synthesized from ren cDNA.…”

“…Renin-expressing cells of the developing metanephros are widespread throughout the nascent renal vasculature, yet their role remains poorly understood (19,20,62). In the embryo, renin cells may secrete active renin for RAS-mediated homeostasis or developmental pathways (42) and, as activated pericytes, may be required for renal angiogenesis (56,58,77).…”