Reliable, scalable functional genetics in bloodstream-form Trypanosoma congolense in vitro and in vivo

Abstract

Animal African trypanosomiasis (AAT) is a severe, wasting disease of domestic livestock and diverse wildlife species. The disease in cattle kills millions of animals each year and inflicts a major economic cost on agriculture in sub-Saharan Africa. Cattle AAT is caused predominantly by the protozoan parasites Trypanosoma congolense and T. vivax, but laboratory research on the pathogenic stages of these organisms is severely inhibited by difficulties in making even minor genetic modifications. As a result, many of the important basic questions about the biology of these parasites cannot be addressed. Here we demonstrate that an in vitro culture of the T. congolense genomic reference strain can be modified directly in the bloodstream form reliably and at high efficiency. We describe a parental single marker line that expresses T. congolense-optimized T7 RNA polymerase and Tet repressor and show that minichromosome loci can be used as sites for stable, regulatable transgene expression with low background in non-induced cells. Using these tools, we describe organism-specific constructs for inducible RNA-interference (RNAi) and demonstrate knockdown of multiple essential and non-essential genes. We also show that a minichromosomal site can be exploited to create a stable bloodstream-form line that robustly provides >40,000 independent stable clones per transfection–enabling the production of high-complexity libraries of genome-scale. Finally, we show that modified forms of T. congolense are still infectious, create stable high-bioluminescence lines that can be used in models of AAT, and follow the course of infections in mice by in vivo imaging. These experiments establish a base set of tools to change T. congolense from a technically challenging organism to a routine model for functional genetics and allow us to begin to address some of the fundamental questions about the biology of this important parasite.

Divergent metabolism between Trypanosoma congolense and Trypanosoma brucei results in differential sensitivity to metabolic inhibition

“…Whilst both 2-deoxy-D-glucose and GlcNAc have a detrimental impact on T. congolense viability, knock-down of the glucose transporter array did not affect growth, even though glucose uptake appeared to be reduced by 37% after 72 h of RNAi induction. Consistent with other studies RNAi penetrance does not appear as efficient as in T. brucei [107] and techniques such as CRISPR/Cas9 and conditional knock-out would greatly enhance our capabilities to study this parasite. Nevertheless, these experiments highlight a crucial difference between BSF T. congolense and T. brucei in a pathway that has become a metabolic paradigm in the latter species.…”

“…Consistent with other studies RNAi penetrance does not appear as efficient as in T . brucei [ 107 ] and techniques such as CRISPR/Cas9 and conditional knock-out would greatly enhance our capabilities to study this parasite. Nevertheless, these experiments highlight a crucial difference between BSF T .…”

“…RNAi experiments were carried out using a T . congolense single marker line, TcoSM [ 107 ] that expresses Tet repressor and T7 polymerase, maintained in 0.5 μg/mL puromycin, and gene specific RNAi constructs were introduced with a T . congolense specific plasmid, p3T7-TcoV [ 107 ].…”

“…In all cases, T. congolense strain IL3000 [51] was used (originally received from Theo Baltz, University of Bordeaux). For RNAi experiments a T. congolense IL3000 single marker line, TcoSM, was used [107]. For in vitro experiments, cells were grown at 34˚C, 5% CO 2 and routinely cultured in either TcBSF3 [17] or HMI-93 [18], in both cases without a serum plus supplement, with 20% goat serum (Gibco).…”

“…RNAi experiments were carried out using a T. congolense single marker line, TcoSM [107] that expresses Tet repressor and T7 polymerase, maintained in 0.5 μg/mL puromycin, and gene specific RNAi constructs were introduced with a T. congolense specific plasmid, p3T7-TcoV [107]. Primers carrying a HindIII (forward) or an FseI (reverse) restriction site were used to amplify a fragment of TcoHT (fwd: AAGCTTAAACAGAGCAATGCCAGTCG; rev: GGCCGGCCTTATTACGTTTGGCATTATG; restriction sites underlined).…”