Relationship between Retroviral DNA Integration and Gene Expression

Abstract

Although retroviruses can integrate their DNA into a large number of sites in the host genome, factors controlling the specificity of integration remain controversial and poorly understood. To assess the effects of transcriptional activity on integration in vivo, we created quail cell clones containing a construct with a minigene cassette, whose expression is controlled by the papilloma virus E2 protein. From these clones we derived transcriptionally active subclones expressing the wild-type E2 protein and transcriptionally silent subclones expressing a mutant E2 protein that binds its target DNA but is unable to activate transcription. By infecting both clones and subclones with avian leukosis virus and using a PCR-based assay to determine viral DNA integration patterns, we were able to assess the effects of both protein binding and transcriptional activity on retroviral DNA integration. Contrary to the hypothesis that transcriptional activity enhances integration, we found an overall decrease in integration into our gene cassette in subclones expressing the wild-type E2 protein.We also found a decrease in integration into our gene cassette in subclones expressing the mutant E2 protein, but only into the protein binding region. Based on these findings, we propose that transcriptionally active DNA is not a preferred target for retroviral integration and that transcriptional activity may in fact be correlated with a decrease in integration.

Vector integration: Location, location, location

“…13 Addition of the transcription factor HNF3 inhibited ASLV end joining at the HNF3 sites. 13 This together with previous data that showed that ASLV integration does not favour transcriptionally active sites 14 would have predicted the Mitchell findings and it is nice to see this so comprehensively confirmed.…”

Relationship between retroviral DNA-integration-site selection and host cell transcription

“…The viral primer (U3-RAV, described in ref. 8, ATCGTCGTGCACAGT-GCCTTT) primes from the antisense strand of RAV-1 U3 LTR sequences, and amplifies an integration product that includes the last 106 bp of the 5Ј end of the integrated provirus. The genomic primer (CACCACCACGGCACTATAAAT) was specific for sequences near the transcription start site of the quail MT gene.…”

“…The PCR assay used to detect region-specific integration products was adapted from that used in previous studies in our laboratory (3,8), and it was done as follows. Genomic DNA isolated from QT6 cells uninfected, infected and induced with 100 g of ZnSO 4 , or infected and uninduced was diluted to 1 g͞ml, heated at 100°C for 5 min, and then placed in an 80°C heating block until addition to the PCR mixture.…”

“…Because the studies cited above did not directly examine the effect of transcription per se on integration, and because our previous data have suggested that there may be fewer integration events into an artificially introduced DNA template when it is undergoing active transcription than when it is not (8), we decided to test the effect of transcription on integration directly by comparing integration events into a highly inducible endogenous gene under both induced and uninduced transcriptional states. The avian metallothionein (MT) gene has a low level of constitutive expression, yet it can be rapidly induced to a very high level by the addition of zinc to the tissue culture medium (9,10).…”

Crystal structures of catalytic core domain of BIV integrase: implications for the interaction between integrase and target DNA

“…Integration is an obligate step in productive retrovirus infection (Weidhaas et al, 2000;Maxfield et al, 2005). Integration of the retroviral DNA into the host cell genome requires the interaction of the retroviral integrase protein with the outer ends of both viral long-terminal repeats (LTRs), thereby removing two nucleotides from the 3¢ ends (3¢ processing), and the newly created 3¢OH attacking a phosphate of the target DNA (strand transfer) (Engelman et al, 1991;Craigie, 2001;Vandegraaff and Engelman, 2007;Delelis et al, 2008).…”