Regulatory function of Arabidopsis lipid transfer protein 1 (LTP1) in ethylene response and signaling

Wang, Honglin; Sun, Yue; Chang, Jianhong; Zheng, Fangfang; Pei, Haixia; Yi, Yan-Jun; Chang, Caren; Dong, Chun-Hai

doi:10.1007/s11103-016-0482-7

Cited by 29 publications

(24 citation statements)

References 56 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…These ethylene-induced ERFs were chosen based on information from The Arabidopsis Information Resource (TAIR) (http://www. arabidopsis.org/) and Wang et al (2016). Our assays indicated that the transcript levels for almost all the examined ERFs in the CPR5-OX (#OX3 and #OX7) were higher than those in the wild type, indicating that increased CPR5 transcript levels promote expression of downstream ERFs in these plants ( Figure 3A).…”

Section: Cpr5 Overexpression Enhances the Ethylene Response And Signamentioning

confidence: 84%

“…To examine the effect of CPR5‐OX on the endogenous transcript levels of ethylene responsive factors ( ERFs ) in the Arabidopsis CPR5 ‐ OX transgenic plants, nine genes ( ERF1 , 2 , 4 , 5 , 8 , 9 , 11 , 104 , and 105 ) were chosen for quantitative RT‐PCR analysis. These ethylene‐induced ERFs were chosen based on information from The Arabidopsis Information Resource (TAIR) (http://www.arabidopsis.org/) and Wang et al (). Our assays indicated that the transcript levels for almost all the examined ERFs in the CPR5 ‐ OX (# OX3 and # OX7 ) were higher than those in the wild type, indicating that increased CPR5 transcript levels promote expression of downstream ERFs in these plants (Figure A).…”

Section: Resultsmentioning

confidence: 99%

“…The ethylene response assay of Arabidopsis seedlings was as previously described (Wang et al ). In brief, seeds were surface sterilized and then sowed on 1/2 MS medium containing ACC at different concentrations (0, 0.5, 5, 20, or 100 μM).…”

Section: Methodsmentioning

confidence: 99%

“…For yeast split‐ubiquitin assays, the open reading frame cDNA fragments of CPR5 and ETR1 were each PCR‐amplified from existing templates with primers ( CPR5‐For (SfiI): ATTGGCCATTACGGCCATGGAAGCCCTCCTCCTCCCT; CPR5‐Rev (SfiI): ATTGGCCATTACGGCCTCAAGCATAGTCAGACCCAC; ETR1‐For (SfiI)‐2: ATTGGCCATTACGGCCGAAGTCTGCAATTGTATTGA; ETR1‐Rev (SfiI)‐2: ATTGGCCGCCTCGGCCGGCATGCCCTCGTACAGTACCCG), cloned into a bait vector pPR3‐N and a prey vector pBT3‐STE through the restriction sites SfiI, and the resultant constructs, CPR5‐pPR3‐N and ETR1‐pBT3‐STE, were obtained, respectively. The vector construction of LTP1 or RTE1 for the yeast split‐ubiquitin assay was as previously described (Wang et al ). The insert sequences were verified by DNA sequencing, and protein interactions were examined, as previously described (Chang et al ).…”

Section: Methodsmentioning

confidence: 99%

See 3 more Smart Citations

Arabidopsis CPR5 regulates ethylene signaling via molecular association with the ETR1 receptor

Wang

Qiao

et al. 2017

JIPB

Self Cite

View full text Add to dashboard Cite

The plant hormone ethylene plays various functions in plant growth, development and response to environmental stress. Ethylene is perceived by membrane-bound ethylene receptors, and among the homologous receptors in Arabidopsis, the ETR1 ethylene receptor plays a major role. The present study provides evidence demonstrating that Arabidopsis CPR5 functions as a novel ETR1 receptor-interacting protein in regulating ethylene response and signaling. Yeast split ubiquitin assays and bi-fluorescence complementation studies in plant cells indicated that CPR5 directly interacts with the ETR1 receptor. Genetic analyses indicated that mutant alleles of cpr5 can suppress ethylene insensitivity in both etr1-1 and etr1-2, but not in other dominant ethylene receptor mutants. Overexpression of Arabidopsis CPR5 either in transgenic Arabidopsis plants, or ectopically in tobacco, significantly enhanced ethylene sensitivity. These findings indicate that CPR5 plays a critical role in regulating ethylene signaling. CPR5 is localized to endomembrane structures and the nucleus, and is involved in various regulatory pathways, including pathogenesis, leaf senescence, and spontaneous cell death. This study provides evidence for a novel regulatory function played by CPR5 in the ethylene receptor signaling pathway in Arabidopsis.

show abstract

Section: Cpr5 Overexpression Enhances the Ethylene Response And Signamentioning

confidence: 84%

Section: Resultsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

See 2 more Smart Citations

Arabidopsis CPR5 regulates ethylene signaling via molecular association with the ETR1 receptor

Wang

Qiao

et al. 2017

JIPB

Self Cite

View full text Add to dashboard Cite

show abstract

“…The plant mbSUS has been successfully used to screen for potential interactions among membrane and signalling proteins of Arabidopsis thaliana (Jones et al, 2014;Lalonde et al, 2010) or for putative targets of chloroplast import receptors (Dutta, Teresinski, & Smith, 2014). Additionally, this approach is often applied to validate interactions with membrane proteins (Anne et al, 2015;Karnik et al, 2015;Wang, Sun, et al, 2016;Zhang et al, 2015).…”

Section: Direct Interactions Revealed By Y2h Screensmentioning

confidence: 99%

Exploring the protein–protein interaction landscape in plants

Struk

Jacobs

Martín-Fontecha

et al. 2018

Plant Cell & Environment

View full text Add to dashboard Cite

Protein-protein interactions (PPIs) represent an essential aspect of plant systems biology. Identification of key protein players and their interaction networks provide crucial insights into the regulation of plant developmental processes and into interactions of plants with their environment. Despite the great advance in the methods for the discovery and validation of PPIs, still several challenges remain. First, the PPI networks are usually highly dynamic, and the in vivo interactions are often transient and difficult to detect. Therefore, the properties of the PPIs under study need to be considered to select the most suitable technique, because each has its own advantages and limitations. Second, besides knowledge on the interacting partners of a protein of interest, characteristics of the interaction, such as the spatial or temporal dynamics, are highly important. Hence, multiple approaches have to be combined to obtain a comprehensive view on the PPI network present in a cell. Here, we present the progress in commonly used methods to detect and validate PPIs in plants with a special emphasis on the PPI features assessed in each approach and how they were or can be used for the study of plant interactions with their environment.

show abstract

Amplification and Adaptation in the Ethylene Signaling Pathway

et al. 2019

View full text Add to dashboard Cite

Plants are exquisitely sensitive to the ethylene signal and also respond to a much wider range of ethylene concentrations than would seem possible based on the simple circuitry of its primary signal transduction pathway, suggesting the existence of mechanisms for amplification and adaptation to ethylene signals. Here, such regulatory systems are considered within the context of what is known about the plant ethylene signaling pathway as well as signaling by the animal G-protein coupled receptors, and the bacterial methyl-accepting chemotaxis proteins.Magnitude amplification and sensitivity amplification mechanisms are considered as strategies for amplification of the ethylene signal. Several families of negative feedback regulators that desensitize plants to ethylene and thereby facilitate the ethylene adaptation response of plants are described. These negative feedback regulators include the ethylene receptors themselves, the reversion-to-ethylene sensitivity1 (RTE1)/greenripe (GR) family, and the auxin-regulated gene involved in organ size (ARGOS) family, all of which function at the level of the ethylene receptors to desensitize plants to ethylene. These negative regulators also include the ein3binding F box protein (EBF) family of F-box proteins, which target the ethylene insensitive3 (ein3)/ein3-lik (EIL) family of transcription factors for degradation. Ethylene signal amplification and adaptation employ both transcriptional and post-transcriptional regulation.

show abstract

Regulatory function of Arabidopsis lipid transfer protein 1 (LTP1) in ethylene response and signaling

Cited by 29 publications

References 56 publications

Arabidopsis CPR5 regulates ethylene signaling via molecular association with the ETR1 receptor

Arabidopsis CPR5 regulates ethylene signaling via molecular association with the ETR1 receptor

Exploring the protein–protein interaction landscape in plants

Amplification and Adaptation in the Ethylene Signaling Pathway

Contact Info

Product

Resources

About