Regulation of transcription by unnatural amino acids

Abstract

Small-molecule regulation of gene expression is intrinsic to cellular function and indispensable to the construction of new biological sensing, control and expression systems. However, there are currently only a handful of strategies for engineering such regulatory components and fewer still that can give rise to an arbitrarily large set of inducible systems whose members respond to different small molecules, display uniformity and modularity in their mechanisms of regulation, and combine to actuate universal logics. Here we present an approach for small-molecule regulation of transcription based on the combination of cis-regulatory leader-peptide elements with genetically encoded unnatural amino acids (amino acids that have been artificially added to the genetic code). In our system, any genetically encoded unnatural amino acid (UAA) can be used as a small-molecule attenuator or activator of gene transcription, and the logics intrinsic to the network defined by expanded genetic codes can be actuated.

High-Yield, Zero-Leakage Expression System with a Translational Switch Using Site-Specific Unnatural Amino Acid Incorporation

“…A sophisticated transcriptional switch by unnatural amino acids via changes in mRNA secondary structures at leader peptide regions has been previously reported (64). The switchability of the transcriptional switch is also expected to be improved by those methods.…”

Principles of genetic circuit design

“…In these systems, orthogonal RNA-IN variants were connected such that expression of any cognate RNA-OUT represses transcription of the output gene. Additional layers of regulation could be engineered into the adapted RNA-IN/OUT system with ligand-responsive aptamers that regulate RNA-OUT activity 143 or tRNAs that control ribosomal pausing in tnaC 144 . A challenge in building larger RNA-IN/OUT circuits is that each transcriptional regulator requires the same tna regulatory element (~290bp).…”

An adaptor from translational to transcriptional control enables predictable assembly of complex regulation

“…First, we introduced BioBrick restriction enzyme sites (BglII/BamHI in combination with HindIII) into the plas- The same cloning procedures were then used to obtain three-input and four-input NOR circuits, yielding pSLQ970 for NOR (4,9,20), pSLQ971 for NOR (3,4,9) and pSLQ948 for NOR (3,4,9,20).…”

“…pCCL-000 is a control plasmid that does not contain the GFP gene, and pCCL-008 contains the superfolder GFP gene, with its own RBS, under the transcriptional control of the wild-type tna regulatory leader-peptide element and driven by a J23119(SpeI) promoter. The construction of plasmids pCCL-000 and pCCL-008 has been described previously 3 . To obtain plasmid pCCL-036, a DNA fragment containing a variant tna element with RNA-IN fused to tnaC was assembled by PCR amplification from pCCL-008 using primers 5′-GGCCACTAGTGCGAAAAATCAA TAAGGAGACAACAAGATGTGCGAACTCGATATGAATATC TTACATATATG-3′ and 5′-CTTCAGCACGCGTCTTGTAG-3′.…”

“…Because of this cis action, the regulatory effects of 5′ UTRs are naturally constrained to the attached genes. As a result, 5′ UTRs have become attractive platforms for a parts-based approach to synthetic regulation in which engineered regulatory parts that sense custom inputs and change the expression of the desired genes in response are integrated [1][2][3][4][5][6][7] . This approach, however, must satisfy two criteria if it is to have longterm success.…”