Regulation of Recombination and Genomic Maintenance

Heyer, Wolf Dietrich

doi:10.1101/cshperspect.a016501

Cited by 92 publications

(103 citation statements)

References 235 publications

Supporting

Mentioning

102

Contrasting

Order By: Relevance

“…Subsequent stabilization of HR intermediates then requires removal of RAD51 from the doublestranded DNA to allow access to the DNA polymerization machinery. Given the central role of the RAD51 filament in HR, its assembly and disassembly are tightly regulated to ensure the fidelity of repair (Krejci et al 2012;Jasin and Rothstein 2013;Heyer 2015).Key mediators of RAD51 filament assembly are the RAD51 paralogs. In humans, there are six RAD51 paralogs: RAD51B, RAD51C, RAD51D, XRCC2, XRCC3, and the newly identified SWSAP1 (Liu et al 2011;Karpenshif and Bernstein 2012;Prakash et al 2015).…”

mentioning

confidence: 99%

See 1 more Smart Citation

Promotion of Homologous Recombination by SWS-1 in Complex with RAD-51 Paralogs in Caenorhabditis elegans

et al. 2016

View full text Add to dashboard Cite

Homologous recombination (HR) repairs cytotoxic DNA double-strand breaks (DSBs) with high fidelity. Deficiencies in HR result in genome instability. A key early step in HR is the search for and invasion of a homologous DNA template by a single-stranded RAD-51 nucleoprotein filament. The Shu complex, composed of a SWIM domain-containing protein and its interacting RAD51 paralogs, promotes HR by regulating RAD51 filament dynamics. Despite Shu complex orthologs throughout eukaryotes, our understanding of its function has been most extensively characterized in budding yeast. Evolutionary analysis of the SWIM domain identified Caenorhabditis elegans sws-1 as a putative homolog of the yeast Shu complex member Shu2. Using a CRISPR-induced nonsense allele of sws-1, we show that sws-1 promotes HR in mitotic and meiotic nuclei. sws-1 mutants exhibit sensitivity to DSBinducing agents and fail to form mitotic RAD-51 foci following treatment with camptothecin. Phenotypic similarities between sws-1 and the two RAD-51 paralogs rfs-1 and rip-1 suggest that they function together. Indeed, we detect direct interaction between SWS-1 and RIP-1 by yeast two-hybrid assay that is mediated by the SWIM domain in SWS-1 and the Walker B motif in RIP-1. Furthermore, RIP-1 bridges an interaction between SWS-1 and RFS-1, suggesting that RIP-1 facilitates complex formation with SWS-1 and RFS-1. We propose that SWS-1, RIP-1, and RFS-1 compose a C. elegans Shu complex. Our work provides a new model for studying Shu complex disruption in the context of a multicellular organism that has important implications as to why mutations in the human RAD51 paralogs are associated with genome instability.KEYWORDS homologous recombination; RAD51 paralog; Shu complex; camptothecin; helq-1 D NA double-strand breaks (DSBs) are extremely cytotoxic lesions that threaten genome integrity. DSBs arise from both endogenous sources, such as replicative damage, or exogenous sources, such as ionizing radiation (IR) and chemotherapeutic agents. To ensure the maintenance of the genome, DSBs need to be repaired by high-fidelity repair pathways, the most robust of which is homologous recombination (HR), in which DNA from a sister chromatid or homologous chromosome provides a repair template. Initial processing of DSB ends by resection forms 39 singlestranded DNA (ssDNA) overhangs that are coated with the ssDNA-binding protein RPA. The exchange of RPA for the recombinase enzyme RAD51 facilitates the homology search and strand invasion of homologous DNA templates to form displacement loop structures. Subsequent stabilization of HR intermediates then requires removal of RAD51 from the doublestranded DNA to allow access to the DNA polymerization machinery. Given the central role of the RAD51 filament in HR, its assembly and disassembly are tightly regulated to ensure the fidelity of repair (Krejci et al. 2012;Jasin and Rothstein 2013;Heyer 2015).Key mediators of RAD51 filament assembly are the RAD51 paralogs. In humans, there are six RAD51 paralogs: RAD51B, RAD51C, RA...

show abstract

mentioning

confidence: 99%

mentioning

confidence: 99%

Promotion of Homologous Recombination by SWS-1 in Complex with RAD-51 Paralogs in Caenorhabditis elegans

et al. 2016

View full text Add to dashboard Cite

show abstract

“…Inactive HR causes loss of faithful DNA repair and leads to genetic instability, whereas excessive HR interferes with cellular processes such as replication, transcription, and telomere maintenance and also can lead to gross chromosomal rearrangements (3). In human cells, the assembly of the RAD51 nucleoprotein filament is aided by the recombination mediator BRCA2 and RAD51 paralogs (9,10), antagonized by antirecombinases (11) and the heteroduplex rejection machinery (12), and is also regulated by posttranslational modifications.…”

mentioning

confidence: 99%

“…This damage is a byproduct of normal cellular metabolism, exposure to radiation, and environmental mutagens (1). Homologous recombination (HR) and the pathways that use the machinery of HR are responsible for the accurate repair of the most deleterious DNA lesions, including double-stranded DNA breaks (DSBs), interstrand DNA cross-links, and damaged replication forks, and thereby contribute to maintenance of the stable genome (2)(3)(4)(5). HR also plays an important role in telomere maintenance (6).…”

mentioning

confidence: 99%

Tyrosine phosphorylation stimulates activity of human RAD51 recombinase through altered nucleoprotein filament dynamics

Subramanyam

Ismail

Bhattacharya

et al. 2016

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

The DNA strand exchange protein RAD51 facilitates the central step in homologous recombination, a process fundamentally important for accurate repair of damaged chromosomes, restart of collapsed replication forks, and telomere maintenance. The active form of RAD51 is a nucleoprotein filament that assembles on single-stranded DNA (ssDNA) at the sites of DNA damage. The c-Abl tyrosine kinase and its oncogenic counterpart BCR-ABL fusion kinase phosphorylate human RAD51 on tyrosine residues 54 and 315. We combined biochemical reconstitutions of the DNA strand exchange reactions with total internal reflection fluorescence microscopy to determine how the two phosphorylation events affect the biochemical activities of human RAD51 and properties of the RAD51 nucleoprotein filament. By mimicking RAD51 tyrosine phosphorylation with a nonnatural amino acid, p-carboxymethyl-L-phenylalanine (pCMF), we demonstrated that Y54 phosphorylation enhances the RAD51 recombinase activity by at least two different mechanisms, modifies the RAD51 nucleoprotein filament formation, and allows RAD51 to compete efficiently with ssDNA binding protein RPA. In contrast, Y315 phosphorylation has little effect on the RAD51 activities. Based on our work and previous cellular studies, we propose a mechanism underlying RAD51 activation by c-Abl/BCR-ABL kinases.RAD51 recombinase | c-Abl tyrosine kinase | homologous recombination | single-molecule total internal reflection fluorescence microscopy | phosphorylation T he DNA in the human genome is constantly subjected to damage. This damage is a byproduct of normal cellular metabolism, exposure to radiation, and environmental mutagens (1). Homologous recombination (HR) and the pathways that use the machinery of HR are responsible for the accurate repair of the most deleterious DNA lesions, including double-stranded DNA breaks (DSBs), interstrand DNA cross-links, and damaged replication forks, and thereby contribute to maintenance of the stable genome (2-5). HR also plays an important role in telomere maintenance (6). HR, a process highly conserved throughout evolution, is carried out through a precisely coordinated and tightly regulated series of events. The key step in HR is the assembly of a RecA-family recombinase (phage UvsX, bacterial RecA, archaeal RadA, or eukaryotic RAD51) onto resected single-stranded DNA (ssDNA). The recombinase forms a nucleoprotein filament that then invades homologous duplex DNA, resulting in a displacement loop structure that can be used as a primer for synthesis using the intact duplex as a template. Similar to its bacterial and yeast homologs, the human RAD51 binds ssDNA in an ATP-dependent manner (7). The nucleoprotein filament formed by the ATP-bound RAD51 is arranged such that each RAD51 monomer binds three nucleotides, forming the pairing unit in these reactions (8). Beyond these basic attributes, the characteristics of human RAD51 protein differ significantly from its archaeal, bacterial, and yeast homologs.The critical role of HR requires all steps of this process ...

show abstract

“…72 For instance, we find TTAGGG in vertebrates, humans, mice, Xenopus, filamentous fungi, Neurospora crassa, the slime molds Physarum and Didymium: TTGGGG in Tetrahymena and Glaucoma; TTGGG(T/G) in Paramecium; TTTTGGGG in Oxytricha, Stylonychia and Euplotes; TTAGGG(T/C) in the apicomplexan protozoan Plasmodium; TTTAGGG in Arabidopsis thaliana; TTTTAGGG in green algae Chlamydomonas; TTAGG in the insect Bombyx mori; TTAGGC in the roundworm Ascaris lumbricoides; TGTGGGTGTGGTG (from RNA template) in Saccharomyces cerevisiae; GGGGTCTGGGTGCTG in Candida glabrata; and GGTGTACGGATGTCTAACTTCTT in Candida albicans. 73 The telomerase, a subspecies of the reverse transcriptase family, cares for telomere replication at the ends of chromosomes and, therefore, not only is a key player of genome maintenance but is also part of an immunity function that provides telomere ends from infection by genetic parasites.…”

Section: Conserved Repetitive Sequences In Dna Archives: Centromeresmentioning

confidence: 99%

Two Genetic Codes: Repetitive Syntax for Active non-Coding RNAs; non-Repetitive Syntax for the DNA Archives

Witzany

2016

Preprint

View full text Add to dashboard Cite

Current knowledge of the RNA world indicates 2 different genetic codes being present throughout the living world. In contrast to non-coding RNAs that are built of repetitive nucleotide syntax, the sequences that serve as templates for proteins share-as main characteristics-a non-repetitive syntax. Whereas non-coding RNAs build groups that serve as regulatory tools in nearly all genetic processes, the coding sections represent the evolutionarily successful function of the genetic information storage medium. This indicates that the differences in their syntax structure are coherent with the differences of the functions they represent. Interestingly, these 2 genetic codes resemble the function of all natural languages, i.e., the repetitive non-coding sequences serve as appropriate tool for organization, coordination and regulation of group behavior, and the nonrepetitive coding sequences are for conservation of instrumental constructions, plans, blueprints for complex protein-body architecture. This differentiation may help to better understand RNA group behavioral motifs.

show abstract

Regulation of Recombination and Genomic Maintenance

Cited by 92 publications

References 235 publications

Promotion of Homologous Recombination by SWS-1 in Complex with RAD-51 Paralogs in Caenorhabditis elegans

Promotion of Homologous Recombination by SWS-1 in Complex with RAD-51 Paralogs in Caenorhabditis elegans

Tyrosine phosphorylation stimulates activity of human RAD51 recombinase through altered nucleoprotein filament dynamics

Two Genetic Codes: Repetitive Syntax for Active non-Coding RNAs; non-Repetitive Syntax for the DNA Archives

Contact Info

Product

Resources

About